[mobile] Low Confidence Metric Tag ADONIS Vollständige Version des Hack-Mods Bitte helfen Sie bei der Suche nach Hack 131

Plattformen = Windows. 2. Dezember 2019. tags = Metrik mit geringer Konfidenz

Last Update: Friday, 21-Feb-20 08:44:41 UTC

▼▼▼▼▼▼▼

https://game-cheat.online/generator

⟰⟰⟰⟰⟰⟰⟰

 

Nat Commun. 2019; 10: 2770. Dieser Artikel wurde von anderen Artikeln in PMC zitiert. Zusammenfassung Die Fähigkeit, die mikrobielle Vielfalt des Bodens mit Bodenprozessen zu verknüpfen, erfordert Technologien, die aktive Mikroben von extrazellulärer DNA und ruhenden Zellen unterscheiden. Hier verwenden wir BONCAT (bioorthogonale nicht-kanonische Aminosäure-Markierung), um translatorisch aktive Zellen in Böden zu messen. Wir vergleichen die aktive Population von zwei Bodentiefen aus Oak Ridge (Tennessee, USA) und stellen fest, dass maximal 25–70% der extrahierbaren Zellen aktiv sind. Die Analyse von 16S-rRNA-Sequenzen aus BONCAT-positiven Zellen, die durch fluoreszenzaktivierte Zellsortierung (FACS) gewonnen wurden, zeigt, dass sich die phylogenetische Zusammensetzung der aktiven Fraktion von der Gesamtpopulation extrahierbarer Zellen unterscheidet. Einige Mitglieder der Gemeinschaft sind unabhängig von ihrem Häufigkeitsgrad in beiden Tiefen aktiv, was darauf hindeutet, dass die Inkubationsbedingungen die Aktivität ähnlicher Organismen begünstigen. Wir schließen daraus, dass BONCAT-FACS die aktive Fraktion von Bodenmikrobiomen in situ wirksam abfragt und einen neuen Ansatz zur Aufdeckung der Zusammenhänge zwischen Bodenprozessen und bestimmten mikrobiellen Gruppen bietet. Fachbegriffe: Bodenmikrobiologie, mikrobielle Ökologie Einleitung Bodengemeinschaften bestehen aus Tausenden von Arten und erreichen eine Dichte von Millionen bis Milliarden von Zellen in jedem Gramm Material 1, 2. Zusammen erfüllen sie wichtige Funktionen des Nährstoffkreislaufs und sind es gemeinsam dominierende Beiträge zu den biogeochemischen Zyklen der Erde 3. Die Sequenzierung der nächsten Generation ermöglicht eine detaillierte Untersuchung der mikrobiellen Taxa in Böden 4 und ermöglicht Vergleiche über eine große Anzahl von Proben mit dem Ziel, die Treiber der mikrobiellen Vielfalt 3, 5, 6 zu bestimmen. Solche vergleichenden Studien zeigen Diversitätsmuster, die in Böden auftreten, insbesondere im Hinblick auf die Korrelation mit edaphischen Faktoren wie pH 7, Bodentextur 8 oder Feuchtigkeitsgehalt 9 oder biologischen Faktoren wie Arten-Arten-Wechselwirkung, Lebensstrategie 10 oder Rang Häufigkeit 6. Jüngste Berichte deuten darauf hin, dass ein großer Teil, möglicherweise bis zu ~ 40%, der mikrobiellen Vielfalt durch molekulare m aus dem Boden gewonnen wird Ethoden können aus toten Zellen oder extrazellulärer DNA 11 stammen, und je nach den Studien 12 bis 14 können bis zu> 95% der Zellen zu einem bestimmten Zeitpunkt inaktiv sein. Daher ist es schwierig, Zusammenhänge zwischen Bodenprozessen und Gemeinschaft zu extrapolieren Zusammensetzung unter Verwendung traditioneller Screening-Methoden 15. Komplementäre Technologien sind erforderlich, um zwischen aktiven Zellen, die Bodenprozesse antreiben, und inaktiven Zellen, die dies nicht tun, zu unterscheiden. 15. Aktive Mikroorganismen wurden zuvor mithilfe der Markierung mit stabilem Isotopensonding (SIP) oder Bromdeoxyuridin (BrdU) identifiziert. SIP umfasst eine Reihe von Methoden, die den Einbau schwerer Isotope in neu synthetisierte DNA und deren Trennung auf einem Dichtegradienten 16 umfassen. SIP unter Verwendung markierter 13 C-Verbindungen hat Aufschluss darüber gegeben, wie das Bodenmikrobiom bestimmte interessierende Moleküle wie Cellulose 17 metabolisiert. Obwohl SIP erfolgreich in Böden implementiert wurde, bleibt es technisch herausfordernd, arbeits- und kostenintensiv 18 und kann durch Kreuzfütterungs- und Markierungsverdünnungseffekte verwechselt werden 19. BrdU ist ein Thymidinanalogon, das von Zellen, die repliziert werden, in die DNA eingebaut wird DNA-Immunabfangen unter Verwendung von BrdU-Antikörpern 20. Dieses Verfahren wurde erfolgreich in Böden zur Untersuchung aktiver Mikroben 21, 22 eingesetzt. Diese Technik weist jedoch auch technische Schwierigkeiten auf, wie beispielsweise eine geringe Markierungseffizienz, für deren Erhalt typischerweise eine große Menge an biologischem Material erforderlich ist ausreichende Menge an markierter DNA für die Sequenzierung 15. Einige neuere Ansätze haben SIP an die Einzelzellanalyse gekoppelt sis verwendet Raman-Mikrospektroskopie oder NanoSIMS, um metabolisch aktive oder neu gebildete Zellen 23 durch Markierung mit H 2 18 O 24 zu verfolgen. Diese Methoden haben jedoch derzeit einen relativ geringen Durchsatz und bieten eine begrenzte phylogenetische Auflösung. Kürzlich wurde das bioorthogonale nicht-kanonische Aminosäure-Tagging (BONCAT) verwendet, um aktive mikrobielle Aggregate aus marinen Sedimenten 25, 26 zu charakterisieren. Dieser Ansatz verwendet ein relativ schnelles Verfahren und geringe Mengen an Material, Eigenschaften, die es für die Untersuchung von Böden attraktiv machen. Die Gemeinschaften werden mit Homopropargylglycin (HPG), einem wasserlöslichen Analogon von Methionin mit einer Alkingruppe, inkubiert, das in neu synthetisierte Proteine ​​27, 28 eingebaut wird. Fluoreszenzfarbstoffe werden dann unter Verwendung einer Azid-Alkin-Klick-Chemie an HPG-haltige Proteine ​​konjugiert. Reaktion 27. Infolgedessen sind Zellen, die während der Inkubation translatorisch aktiv waren, fluoreszenzmarkiert und können durch fluoreszenzaktivierte Zellsortierung (FACS) 26 spezifisch gewonnen werden. Im Vergleich zu anderen Methoden der Aktivitätsmarkierung ist BONCAT schneller und weniger mühsam Die "Klick-Chemie" -Reaktion dauert weniger als 2 Stunden. Vielleicht noch wichtiger ist, dass BONCAT neu hergestellte Proteine ​​markiert und daher nicht auf Zellteilung und DNA-Synthese angewiesen ist, was kurzfristige Inkubationen (Minuten bis Stunden) und die Abfrage sich langsam teilender Zellen erleichtert. Hier berichten wir über den erfolgreichen Einsatz von BONCAT zur Untersuchung aktiver Mitglieder des Bodenmikrobioms sowie über die Integration von BONCAT in die FACS-Zellsortierung und Sequenzierung der aktiven Bodenzellen. Für diese Studien haben wir Böden von der ORFRS-Stelle (Oak Ridge Field Research Site) mit HPG inkubiert und markierte Zellen mit FACS sortiert. Die Zusammensetzung der aktiven Gemeinschaft wurde durch 16S-rRNA-Genamplikonsequenzierung bestimmt. Die Ergebnisse wurden mit der Zusammensetzung der gesamten Bodengemeinschaft sowie mit den ~ 700 Isolaten verglichen, die von demselben Feldstandort gesammelt wurden. Diese Analysen zeigen, dass ein großer Teil der aktiven extrahierbaren Mikroben nahe Verwandte in der lokalen Isolatsammlung und in den wichtigsten Bodentaxa hatte, die in einer kürzlich durchgeführten globalen Bodenuntersuchung 29 identifiziert wurden. Ergebnisse und Diskussion HPG wird von Zellen in situ aktiv eingebaut. Wir bewerteten den Nutzen von BONCAT zur Identifizierung translatorisch aktiver Zellen aus Bodensystemen, die aus einer sehr heterogenen Matrix bestehen, und wir haben BONCAT mit FACS gekoppelt, um einzelne aktive Zellen nachzuweisen und zu gewinnen, im Gegensatz zu mikrobiellen Aggregaten, die aus Hunderten von Zellen bestehen. 26. Bodenproben wurden am ORFRS in gesammelt Oak Ridge, TN, USA, wurden für die Analyse von zwei verschiedenen Gemeinschaften horizontal in 30 cm und 76 cm unter der Oberfläche entkernt (Abb. 1a). Der 30-cm-Boden hatte mehr Quarz und weniger Glimmer als die 76-cm-Probe, die aus mehr Ton bestand (ergänzende Abb. 1). Keine dieser Proben hatte eine nachweisbare Menge an Methionin basierend auf LC-MS und daher ist es unwahrscheinlich, dass es eine signifikante Konkurrenz von Methionin um den Einbau von HPG gab (ergänzende 2). Durchführen von BONCAT-FACS an Bodenproben. a Einzelheiten zu den Inkubationsbedingungen der Bodenproben von 76 cm und 30 cm. Die Proben wurden dreifach inkubiert und drei Zeitpunkte wurden sortiert. b Die Gate-Zeichnung erfolgte in zwei Schritten. Zuerst wurden die Zellen anhand ihrer SYTO59-Fluoreszenz (Beispiel: 640 nm / Em: [655–685 nm]) von den Hintergrundpartikeln getrennt, wie durch das blaue Gate dargestellt die obere Platte. Die SYTO + -Zellen wurden weiter auf ihre BONCAT-Fluoreszenz mit dem FAM-Picolyl-Farbstoff (Beispiel: 488 nm / Em: 530 nm) analysiert. Das mittlere Feld zeigt ein Beispiel einer Kontrollprobe, die mit Wasser inkubiert und angeklickt wurde (Wasser-HPG-Kontrolle). Das BONCAT-Gate (in Grün) wurde so eingestellt, dass weniger als 0,5% der Ereignisse in dieses Gate fallen (falsch positiv) ). Das untere Feld ist ein Beispiel dafür, wie die BONCAT + - und BONCAT - Gates in einer HPG-inkubierten Probe eingesetzt wurden. Beachten Sie, dass das grüne Gate das gleiche ist wie in der Kontrollprobe. c Die Gesamtzahl der extrahierten Zellen im Zeitverlauf zeigt ~ 20 Millionen Zellen pro Gramm bei 30 cm und ~ 5 Millionen Zellen pro Gramm bei 76 cm. d Zeitliche Dynamik der BONCAT + -Markierung (ausgedrückt als Prozent der extrahierbaren Zellen) für die 30-cm- und die 76-cm-Probe. Fehlerbalken stellen die Standardabweichung dar (n = 3). Um zu bestätigen, dass HPG in situ von den Zellen aktiv eingebaut wurde, führten wir ein abgetötetes Kontrollexperiment auf dem 76 cm Boden mit doppelten Proben für jede Behandlungsbedingung durch. Die Zellen wurden entweder vor oder nach der Inkubation mit HPG durch Zugabe von Paraformaldehyd (3% Endkonzentration) fixiert. Vor der HPG-Inkubation fixierte Zellen erhielten nach den Klickreaktionen keine Fluoreszenz. In ähnlicher Weise erhielten auch nicht fixierte Zellen, die ohne HPG inkubiert wurden, keine Fluoreszenz (siehe 1b für ein Beispiel, wie Sortiertore bestimmt wurden). Im Gegensatz dazu erhielten sowohl nicht fixierte Zellen als auch nach HPG-Inkubation fixierte Zellen ein deutliches grünes Fluoreszenzsignal, das der Azidfarbstoffzugabe zu den BONCAT-markierten Zellen entsprach. Der Anteil fluoreszierender Zellen und die Fluoreszenzintensitäten pro Zelle waren zwischen nicht fixierten und nach der Inkubation fixierten Zellen vergleichbar, obwohl sich die allgemeine Form der analysierten Ereigniswolken in den Zytogrammen unterschied (ergänzende 3, ergänzende Tabelle 2). Dies bestätigte, dass HPG nur von aktiven Zellen eingebaut wurde und dass für die Cycloaddition des BONCAT-Azid-Fluoreszenzfarbstoffs keine Fixierung erforderlich war, wie zuvor berichtet 26, 28. Daher wurden alle zusätzlichen Experimente mit nicht fixierten Zellen durchgeführt, um die negativen Auswirkungen von Paraformaldehyd zu vermeiden Fixierung bei anschließender PCR-Amplifikation von 16S-rRNA-Genen 30. Vergleich der extrahierbaren Zellen mit der gesamten Bodengemeinschaft Obwohl der Boden direkt vom Bodenkern übertragen und während der Inkubation nicht gerührt wurde, mussten die Zellen nach der Inkubation mit von der Bodenmatrix abgelöst werden HPG und auf einem 0,2 um Filter (siehe Methoden, Ergänzungstabelle 3) für die anschließende Klickreaktion und FACS eingefangen. Wir bewerteten die Auswirkungen dieses Disaggregationsschritts auf die Zusammensetzung der Gemeinschaft, da er die extrazelluläre DNA 11 und die Zellen, die einen 0,2-µm-Filter passieren, herausfiltern würde. Der Disaggregationsschritt könnte sich auch auf die Zusammensetzung der Gemeinschaft auswirken, wenn sich einige Gruppen bevorzugt von den Bodenaggregaten lösen. Daher verglichen wir die 16S-rRNA-Zusammensetzung der aus Schüttgut extrahierten DNA mit der Zusammensetzung der abgelösten Zellen, die auf der 0 eingefangen wurden. Die Struktur der mikrobiellen Gemeinschaft, die aus der gesamten Boden-DNA-Reinigung bei 30 cm und 76 cm gewonnen wurde, unterschied sich auf Phylum-Ebene (Fig 2a und ergänzende Abb. 5). Zum Beispiel wurde der 30-cm-Boden von Acidobakterien sowie den Kandidaten Phlya AD3 und GAL15 dominiert. Der 76-cm-Boden wurde größtenteils von Proteobakterien mit einem höheren Anteil an Bacteroidetes dominiert als im 30-cm-Boden. Auf der Merkmalsebene (auch als exakte Sequenzvariante (ESV) bezeichnet, dh Sequenzen, die mit 100% Ähnlichkeit entrauscht und geclustert wurden) war in beiden Tiefen das am häufigsten vorkommende Merkmal eine Alphaproteobacterium-Gattung Aquamicrobium, die 8,77% und 72,9% ausmachte der analysierten Sequenzen von 30 cm Vollboden bzw. 76 cm Vollboden. Dieses Merkmal wurde nur teilweise auf den 0,2 um-Filtern erfasst (es entsprach 2,4% bzw. 3,1% für die 76-cm- und 30-cm-Filter), was durch (i) eine technische Verzerrung bei der Bestimmung erklärt werden könnte relative Häufigkeit 31 oder (ii) nicht ausschließlich die Tatsache, dass dieses Taxon größtenteils als extrazelluläre DNA im Boden vorliegt, nicht effizient vom Boden abgelöst wurde oder von geringer Größe ist und nicht vom Filter zurückgehalten wird, wie in der Beschreibung von Aquamicrobium vorgeschlagen Stämme 32, 33. Die Anzahl der operativen taxonomischen Einheiten (OTUs; Merkmale, die bei 97% Ähnlichkeit geclustert sind), die auf den Filtern für die 30-cm-Probe erfasst wurden, war die Hälfte der Anzahl, die aus dem gesamten Boden gewonnen wurde, während die Anzahl der bei 76-cm-Filtern erfassten Filter größer war als oder gleich der vollständigen Bodenprobe im Durchschnitt (Ergänzungstabelle 1). Die OTUs, die auf der 76-cm-Filterprobe vorhanden waren und nicht im Boden gefunden wurden, wurden in geringer Häufigkeit (<0,1%) gefunden und könnten von den seltenen Mitgliedern des Bodenmikrobioms stammen. Wie erwartet war die Gemeinschaftszusammensetzung der auf einem Filter eingefangenen extrahierbaren Zellfraktion nicht identisch mit den Bodenbibliotheken. Da die BONCAT-Markierung und Zellsortierung an den gesamten Zellen durchgeführt wurde, die auf einem Filter erfasst wurden, der im Rest des Manuskripts als "extrahierbare Fraktion" bezeichnet wird, werden die Ergebnisse sortierter Zellen mit der extrahierbaren Fraktion verglichen, sofern nicht anders angegeben. Es ist erwähnenswert, dass die extrahierbare Fraktion auch ein besserer Ersatz für die intakte zelluläre Fraktion des Bodenmikrobioms sein könnte, da sie extrazelluläre DNA 11 herausfiltert, die zu Sequenzierungsergebnissen von aus Bulk-Boden extrahierter DNA führen kann. Zusammensetzung der Gesamtgemeinschaft und sortierter Fraktionen (16S-rRNA-Gensequenzierung). eine mikrobielle Diversität, die auf Phylum-Ebene für alle analysierten Proben angezeigt wird. b Rang vs. Häufigkeit (absolute Häufigkeit aus der verdünnten OTU-Tabelle bei einer gleichmäßigen Tiefe von 81000 Sequenzen, siehe „Methoden“) Diagramm in Log-Log-Skala der Bibliotheken gemittelter biologischer Replikate, Standardabweichungen werden als Fehlerbalken angezeigt (n = 3). c NMDS-Ordination des paarweisen Bray Curtis-Abstands aller Bibliotheken. In der BONCAT + -Probengruppe wird eine 95% -Konfidenzellipse angezeigt. "Bulk Soil" -Proben sind Bibliotheken, die aus der aus dem Boden extrahierten Gesamt-DNA aufgebaut sind. "Filter" -Proben sind DNA, die aus allen vom Boden abgelösten und auf einem 0,2-µm-Filter eingefangenen Zellen extrahiert wurde. BONCAT + - und BONCAT– -Bibliotheken wurden aus entsprechenden zellsortierten Proben konstruiert Verfolgung der aktiven Zellfraktion über die Zeit unter Verwendung von BONCAT Um einzelne aktive Zellen in Böden zu identifizieren, wurden Proben von 30 cm und 76 cm mit HPG bis zu einer Woche (168 h) mit periodischer Probenahme und anschließender Fluoreszenzmarkierung inkubiert. Die Gesamtzahl der Zellen betrug ~ 20 Millionen Zellen g –1 Boden bei 30 cm und ~ 5 Millionen Zellen g –1 Boden bei 76 cm (1b). Die Zellpopulation nahm mit der Zeit zu (Pearson R = 0,45, p = 0,062 und Pearson R = 0,76, p <0,005 bei 30 bzw. 76 cm), was darauf hinweist, dass keine akute Toxizität zu einem massiven Zellverlust führte noch eine Stimulation, die zu einer massiven Blüte der Zellpopulation während der Inkubationen führt. Obwohl in anderen Böden 34 über höhere Zelldichten berichtet wurde, waren unsere Bodenproben oligotrop (ergänzende Abb. 1), mit sehr geringem Stickstoffgehalt (<0,05%), keiner nachweisbaren Phosphormenge und einem TOC (<0,15) %) in der gleichen Größenordnung wie kahle, trockene Landböden 35. Darüber hinaus konnten wir nur 0,5–33 ng DNA pro g Boden isolieren, während andere Böden häufig Mikrogramm DNA pro Gramm Boden 34 liefern Beobachtungen deuten darauf hin, dass diese Böden möglicherweise nur eine kleine Zellpopulation aufnehmen können, und wir sind daher zuversichtlich, dass die extrahierbare Zellfraktion in dieser Studie (10 6 –10 7 Zellen pro Gramm Boden, Abb. 1c) einen großen Anteil von darstellt das Bodenmikrobiom. Die Fraktion der BONCAT + -Zellen (Fig. 1b, d) nahm in beiden Bodenproben mit der Zeit zu (Fig. S4), wobei für beide Bodenproben eine unterschiedliche Markierungsrate und Fraktion der markierten Zellen nachgewiesen wurde. Beispielsweise wurden Zellen aus dem 76-cm-Boden schnell markiert (klare BONCAT + -Population war bereits nach 30-minütiger Inkubation sichtbar) und ~ 60% aller extrahierbaren Zellen wurden innerhalb von 48 Stunden markiert, während Zellen aus dem 30-cm-Boden langsamer markiert wurden (keine BONCAT-Markierung nach 1 h) und nur ~ 20% Gesamtzellen wurden nach 48 h markiert (Fig. 1d und ergänzende Fig. 4). Diese Unterschiede, die zwischen den biologischen Replikaten konsistent waren, legen nahe, dass die bei 76 cm gefundene mikrobielle Gemeinschaft hauptsächlich aus aktiven Zellen bestand, während die Gemeinschaft bei 30 cm einen größeren Anteil an inaktiven Zellen aufwies. Frühere Studien ergaben, dass zu jedem Zeitpunkt nur ein kleiner Teil der Zellen (nur 0–2%) aktiv war 12, was die Ansicht prägte, dass die meisten Bodenmikroben ruhend sind 13, 14. In dieser Studie etwa 20% oder Weitere der von uns analysierten extrahierbaren Zellen waren in beiden Tiefen aktiv, und der 76-cm-Boden erreichte diesen Wert in nur 30 Minuten Inkubation. Die hohe Anzahl aktiver Zellen, die wir gefunden haben, könnte mit der Tatsache zusammenhängen, dass wir translatorisch aktive Zellen markiert haben, während andere Techniken normalerweise aktiv teilende Zellen untersuchen und sich daher gegen langsame Züchter richten. Die Inkubationsbedingungen, die ein natürliches Ereignis wie einen starken Regen nachahmen, der den Boden sättigt, haben möglicherweise auch den Anteil der aktiven Zellen beeinflusst. Ähnliche Experimente mit anderen Aktivitätsprüfverfahren mit unterschiedlichen Inkubationsbedingungen und Bodentypen zeigen das Ausmaß der Variation, die die aktive Fraktion unter natürlichen klimatischen Bedingungen erfährt. Die aktive Fraktion ist eine ausgewählte Untergruppe der Gesamtgemeinschaft. Um die Identität extrahierbarer aktiver Zellen zu bestimmen, sequenzierten wir die 16S-rRNA-Gene von BONCAT + -Zellen aus 30- und 76-cm-Bodenproben. Insbesondere dreifache Sammlungen von 35k - 75k BONCAT + -Zellen, die durch FACS gewonnen wurden (2-stündige Inkubation der 76-cm-Probe und 48-stündige Inkubation der 76- und 30-cm-Proben) und mittels iTag-Sequenzierung charakterisiert wurden (Ergänzungstabelle 1). Beide Böden wurden zum Zeitpunkt von 48 Stunden sequenziert, da dies den Beginn der Plateau-Phase der BONCAT-Markierung für beide Kerne darstellt (1d). Für den 76 cm Boden wurde auch der 2-Stunden-Zeitpunkt sequenziert, um Zellen zu identifizieren, die schnell markiert wurden. Zu diesen Zeitpunkten wurden auch nicht markierte Zellen (BONCAT-) sortiert und sequenziert (Fig. 1a). Um die BONCAT-sortierten Fraktionen in großem Maßstab mit der Gesamtgemeinschaft zu vergleichen, haben wir den Rang gegen die Häufigkeit aller Bibliotheken aufgetragen (Abb. 2b). Dieses Diagramm zeigt deutlich, dass sich die BONCAT + -Populationen von den übrigen Proben unterschieden, wobei eine steilere Steigung einen schnelleren Abfall der Diversität in höheren Rängen widerspiegelte. Das Muster für BONCAT− -Proben war ähnlich wie bei den extrahierbaren Zellen (Filterproben). Um festzustellen, ob dieser Unterschied von der Variation der Zusammensetzung herrührt, haben wir eine Beta-Diversity-Metrik (Bray-Curtis-Maß für die Unähnlichkeit) berechnet und ordiniert und paarweise zwischen den Proben geordnet (Abb. 2c). Das resultierende NMDS-Diagramm zeigte, dass alle BONCAT + -Fraktionen sowohl von 30 als auch von 76 cm eine vom Rest der Proben getrennte Gruppe bildeten (Adonis, F = 2,65, p-Wert = 0,001). Diese Analyse stützt die Beobachtung, dass die BONCAT− -Zellfraktion den gesamten extrahierbaren Zellen ähnelt, während sich die gesamten DNA-Proben weiter entfernt befinden. Diese Ergebnisse zeigen auch, dass die Pools von BONCAT− -Zellen, obwohl sie im Vergleich zum Kontrollboden und den extrahierbaren Zellen eine geringere Diversität aufweisen, eine zufällige Untergruppe der Bodengemeinschaft waren, während die BONCAT + -Fraktion eindeutig aus einer bestimmten und reproduzierbaren Untergruppe der Gemeinschaft bestand .Bei der Analyse der Phylogenie der BONCAT + -Proben auf Phylum-Ebene stellten wir fest, dass bei 30 cm die extrahierbare aktive Fraktion von Actinobakterien dominiert wurde (Abb. 2a und ergänzende Abb. 5), wobei ein Arthrobacter OTU ~ 51% der gewonnenen Sequenzen umfasste im Durchschnitt ("h" Abb. 3a), während die 76 cm aktive Population von Proteobakterien dominiert wurde. Auf OTU-Ebene (Merkmale mit 97% Ähnlichkeit) (Abb. 3) waren die BONCAT-positiven OTU h-e-f unabhängig von ihrer Häufigkeit in der Elternpopulation sowohl bei 30 cm als auch bei 76 cm hoch aktiv. Zum Beispiel wurde OTU h Arthrobacter nur in geringer Häufigkeit (Rang 214) aus den extrahierbaren Zellen gewonnen, während es für diese Probe die am häufigsten vorkommende OTU in der BONCAT + -Fraktion ist. Im Gegensatz dazu waren die am häufigsten vorkommenden Mitglieder der 76-cm-Gemeinschaft (z. B. OTU a Abb. 3) BONCAT -, was darauf hinweist, dass sie nicht auf die Inkubationsbedingung reagierten. Diese Beobachtungen legen nahe, dass die Aktivität einer OTU nicht allein aufgrund ihrer Häufigkeit in der Elterngemeinschaft vorhergesagt werden konnte. Vergleich der Zusammensetzung der BONCAT + - und BONCAT− -Populationen. a Relative Häufigkeit (in Prozent ± SD, n = 3) der in BONCAT + (rot) und BONCAT− (blau) vorhandenen OTUs für die Inkubation von 30 cm bis 48 Stunden (linkes Feld), Inkubation von 76 cm bis 2 Stunden (Mitte) Panel) und 76 cm - 48 h Inkubation (rechtes Panel). Die OTUs wurden in absteigender Reihenfolge von links nach rechts entsprechend ihrer relativen Häufigkeit auf den Filterproben (alle Zellen wurden abgetrennt und auf einem Filter erfasst) eingestuft. b Nahaufnahme der 30 am häufigsten vorkommenden OTUs, die mit ihrer Häufigkeit auf den Filterproben überlagert sind (gestrichelte Linie, ± SD zeigt als graue Schattierung n = 3). Die am häufigsten vorkommenden OTUs sind von a bis k indiziert. Ihre Taxonomie, ID, die in der ENIGMA-Kultursammlung enthalten ist und mit dem 511 am häufigsten vorkommenden Bodenmikrobiom 29 übereinstimmt, ist auf der rechten Legendenanzeige angegeben. Fehlerbalken stellen die Standardabweichung dar (n = 3) Obwohl wir zuversichtlich sind, dass die BONCAT + -Fraktion aus translatorisch aktiven Zellen besteht, sollte der relative Anteil der OTUs in jeder Bibliothek mit einiger Vorsicht als mögliche Verzerrung durch PCR bei der Herstellung der iTags interpretiert werden Die Bibliotheken 31, 36 und das Sortieren (in der Ablösung von den Filter- und DNA-Färbungsschritten) können Schätzungen der relativen Häufigkeit beeinflussen. Genauer gesagt machen einige OTUs den Großteil der in den BONCAT-Fraktionen abgerufenen Sequenzen aus, während ihre Häufigkeit in der gesamten extrahierbaren Gemeinschaft geringer war. Angesichts der Tatsache, dass die Größe der extrahierbaren Gesamtpopulation während der ersten 48 Stunden der Inkubation nur geringfügig zunahm, kann dies durch zwei nicht ausschließliche Hypothesen erklärt werden: (i) einige technische Verzerrungen bei der Bestimmung der relativen Häufigkeit oder (ii) reales Wachstum bestimmter OTUs ausgeglichen durch den Verlust anderer Mitglieder. Während unser experimentelles Design es uns nicht erlaubt, zwischen bereits aktiven und während der Inkubation aktiven Mikroben zu unterscheiden, scheint es vernünftig anzunehmen, dass das von uns gemessene Signal möglicherweise eine Mischung aus beiden Typen ist. Beim Versuch eines Vergleichs der mit 76 cm Probe extrahierbaren BONCAT + -Zellen nach 2 und 48 Stunden Inkubation stellen wir fest, dass die OTU j abfiel, während die relative Häufigkeit von OTU e und h zunahm (3). Wir schließen daraus, dass BONCAT eine vielversprechende Methode ist, um die Dynamik der Zeitgemeinschaft auf OTU-Ebene abzufragen. Ein weiteres interessantes Ergebnis dieser Studie ist, dass das BONCAT + -Signal unabhängig von der Größe der Gesamtpopulation bei etwa 4 Millionen aktiven Zellen pro Gramm Boden ein Plateau erreichte. Das BONCAT + -Plateau kann auf die Erschöpfung von HPG durch die Zellen oder dessen Sorption an die Bodenpartikel zurückzuführen sein, oder es gab möglicherweise eine Ressourcengrenze innerhalb dieser Proben, die die Gesamtzahl der aktiven Zellen in jeder Bodenprobe kontrollierte. Es ist auch möglich, dass einige aktive Zellen aufgrund ihrer Unfähigkeit, HPG einzubauen, nicht markiert wurden. Zu diesem Zeitpunkt ist es nicht möglich zu bestimmen, welches Szenario das beobachtete Plateau in unserer Studie erklärt, aber die Tatsache, dass BONCAT + -Zellen zu 251 verschiedenen OTUs gehörten, die 17 bakterielle Phyla überspannten und bis zu ~ 70% der extrahierbaren Zellen ausmachten, legt nahe, Wie bereits erwähnt, 25, 26, 37, wird HPG tatsächlich von einem großen Satz mikrobieller Spezies eingebaut. Vergleich von BONCAT + -Zellen mit Bodenisolaten und Phylotypen Wir untersuchten, wie die Zusammensetzung einer aus derselben Versuchsstelle erzeugten Kultursammlung (siehe „Methoden“ und ergänzende Daten 1) mit der Diversität der aktiven und vermutlich ökologisch relevanten Fraktion von verglichen wurde die Gemeinde. Insbesondere verglichen wir 16S-rRNA-Gensequenzen von BONCAT + -Zellen und Gesamtzellbibliotheken (sowohl Gesamtboden als auch extrahierbare Zellen) mit 16S-rRNA-Gensequenzen von 687 Isolaten, die an derselben Stelle gesammelt wurden (ergänzende Daten 1). Überraschenderweise hatten zwischen 77 und 98% der Gesamtsequenzen von BONCAT + -Zellen eine Sequenzähnlichkeit von> 97% mit den Isolaten. Während die relativen Häufigkeiten aufgrund möglicher Auswirkungen der Amplifikation oder Sortierverzerrung 31, 38 mit einiger Vorsicht interpretiert werden sollten, deuten diese Ergebnisse darauf hin, dass ein großer Teil der aktiven extrahierbaren Gemeinschaft eng kultivierte Vertreter hatte. Diese Ergebnisse zeigen auch, dass die Kultursammlung eine wichtige Ressource für die Untersuchung der Zusammenhänge zwischen Bodengemeinschaften und ökologischen Prozessen am Untersuchungsort Oak Ridge sein wird. Die Beobachtung, dass ein wesentlicher Teil der aktiven extrahierbaren Zellen Verwandte kultiviert hat, stimmt gut mit dem kürzlich veröffentlichten Beitrag von Delgado-Baquerizo et al. 29, die eine Liste von 511 Phylotypen (OTUs mit 97% Cutoff) identifizierten, die 44% der mikrobiellen Vielfalt der Böden weltweit umfassen. Von diesen Phylotypen hatten 45% einen kultivierten Vertreter, was darauf hindeutet, dass die Kultivierungsbemühungen bereits dazu geführt haben, Vertreter allgegenwärtiger Bodentaxa zu isolieren. Um unseren Datensatz weiter mit diesen 511 allgegenwärtigen Bodenphylotypen zu vergleichen, haben wir BLAST mit einer Reihe repräsentativer Sequenzen unserer OTUs für Bibliotheken durchgeführt und die> 97% Treffer wiederhergestellt (Abb. 4a, b). Wir fanden heraus, dass es eine Überlappung zwischen den in unserer Kultursammlung gefundenen Sequenzen und den 511 Referenzphylotypen 29 gab. Drei der am häufigsten gefundenen BONCAT + OTUs gehörten zu den 511 prominenten Mitgliedern des globalen Atlas für Bodenmikrobiom 29 (z. B. OTU g) , h, i Abb. 3, 100% Sequenzähnlichkeit), was die Idee weiter unterstützt, dass kultivierte Isolate für das Verständnis des Bodenmikrobioms in dieser Studie besonders relevant sein könnten. Prävalenz von Bodenisolaten und allgegenwärtigen Boden-OTUs bei BONCAT + -Zellen. a Prozentmerkmale (nicht geclusterte DADA2-Ergebnisse) und b Prozent Sequenzen aus den aktuellen Bibliotheken mit einem Treffer (> 97% Sequenzähnlichkeit) in der ENIGMA-Kultursammlung (diese Sammlung enthält 697 16S-rRNA-Gene voller Länge aus Stämmen, aus denen isoliert wurde die gleiche Feldstelle wie die in dieser Studie betrachteten Proben (grün), in der Gruppe von 511 Phylotypen, die von 29 (gelb) oder beiden (gestrichelter Bereich) als am häufigsten identifiziert wurden. Die Daten sind durchschnittlich (n = 3) ± SD, Buchstaben zeigen ANOVA post hoc signifikante Unterschiede an. "Boden" -Proben sind Bibliotheken, die aus der aus dem Boden extrahierten Gesamt-DNA konstruiert wurden. "Filter" -Proben sind DNA, die aus allen vom Boden abgelösten und auf einem 0,2-µm-Filter eingefangenen Zellen extrahiert wurde. BONCAT + - und BONCAT-Bibliotheken wurden aus entsprechenden zellsortierten Proben konstruiert. Schlussfolgerungen Wir finden, dass BONCAT ein nützliches Werkzeug für die Analyse der aktiven Fraktion von Bodenmikrobiomen ist, wenn es an fluoreszenzaktivierte Einzelzellsortierung und -sequenzierung gekoppelt ist. Dies ermöglicht die Trennung aktiver Zellen von extrazellulärer DNA, ruhenden Mikroben und toten Zellen. BONCAT kann als Filter angesehen werden, der Umwelt-DNA-Analysen auf die aktive und wahrscheinlich ökologisch relevante extrahierbare Zellfraktion konzentriert. Wie bei jedem Filter kann das BONCAT-Verfahren auch einige Verzerrungen mit sich bringen, und es muss mit anderen Aktivitätsprüfstrategien verglichen und in einer größeren Vielfalt von Bodentypen getestet werden. Wir haben jedoch gezeigt, dass BONCAT-FACS verwendet werden kann, um die Dynamik der aktiven Zellpopulation zu verfolgen und das Verhalten aktiver Mitglieder auf Phylum- oder OTU-Ebene zu analysieren. Unsere Experimente führten zu einer konsistenten Anreicherung eines bestimmten Satzes von Organismen in der BONCAT + -Fraktion, was die Reproduzierbarkeit des BONCAT-FACS-Ansatzes bestätigte. Überraschenderweise stellten wir fest, dass ein großer Teil der extrahierbaren Zellen unter unseren Inkubationsbedingungen aktiv war (20–60%) und dass die Sequenzen aus der aktiven Population enge Vertreter in der Kultursammlung hatten, die von derselben Probenahmestelle aus erstellt wurde. Obwohl die biologischen Ergebnisse dieser Studie auf die hier angegebenen spezifischen Böden und Inkubationsbedingungen beschränkt sind, zeigen unsere Daten, dass die BONCAT-Kennzeichnung auf machbare, robuste und reproduzierbare Weise auf den Boden angewendet werden kann und in der zukünftigen Bodenmikrobiomforschung weit verbreitet sein könnte. Methoden Beschreibung des Rahmenprojekts dieser Studie Diese Studie und die Proben sind Teil des ENIGMA-Projekts (Ecosystems Networks Integrated with Genes and Molecular Assemblies) (), eines DOE-SFA mit mehreren PIs (Department of Energy Science Focus Area). Der ENIGMA-Feldstandort wurde bereits untersucht 39, und dieser Studie wurde eine Kultursammlung von Isolaten aus diesem genauen Feldstandort zur Verfügung gestellt. Diese wird im Haupttext als „Kultursammlung“ bezeichnet (ergänzende Datei). Probenentnahme- und Inkubationsbedingung Zwei Probenbodenkerne mit 4 cm Durchmesser wurden am 24. Januar 2017 horizontal aus Oak Ridge, TN (GPS 35. 941133, −84. 336504) aus einem Schlammlehmgebiet entnommen. Ein vertikaler Graben wurde hergestellt und ein erster Kern wurde in 30 cm Tiefe entnommen, während der zweite in 76 cm Tiefe gesammelt wurde. Beide Kerne wurden gekühlt versandt und bis zur Verarbeitung im Dunkeln bei 4 ° C gelagert. Zum Zeitpunkt des Experiments (innerhalb von 1–3 Monaten nach der Entnahme) wurde für jedes Replikat unter sterilen Bedingungen ein Stück ~ 1 g Erde aus dem distalen Teil des Kerns entnommen und in eine 14-ml-Schnappkappe aus Polystyrol mit zwei Positionen gegeben wurde in der oberen Position gehalten, um den Gasaustausch durch die Inkubation zu ermöglichen. Jedes Replikat wurde mit 2 ml 50 uM L-Homopropargylglycin (HPG, Click Chemistry Tools, Scottsdale, AZ, USA) in sterilem Wasser (DEPC-Diethylpyrocarbonat-behandeltes filtersterilisiertes Wasser, pH 7) bei 15ºC im Dunkeln inkubiert Es wurde ein Mischverfahren angewendet (dh wir haben keine Bodenaufschlämmung hergestellt) und der Kopfraum betrug 12 ml. Diese Temperatur wurde gewählt, weil es sich um die durchschnittliche Oberflächentemperatur am Feldstandort handelt. Die Inkubation wurde aerob durchgeführt, da Daten aus dem Feld darauf hinweisen, dass der Boden in diesem Bereich oberhalb von 1 m aerob ist (T. Hazen, persönliche Mitteilung). Zwei Milliliter reichten aus, um die für jedes Replikat verwendeten 1 g Boden vollständig einzutauchen. Dieser Hydratationsgrad stellte sicher, dass alle Bodenporen vollständig überflutet waren und keine Diffusionsbeschränkung für HPG bestand. Die Zugabe von 2 ml verdünnte die gelösten Bodenstoffe und könnte ein Feldereignis darstellen, das einem starken Regen entspricht, der den Boden überfluten kann. Kontrollproben wurden unter den gleichen Bedingungen mit Wasser, jedoch ohne HPG (Wasser-HPG-Kontrolle) inkubiert. Das vollständige Inkubationsdesign ist in Abb. 1a dargestellt. Am Ende der Inkubationszeit (über 0,5–168 h) wurden jeweils 5 ml 0,02% Tween® 20 (Sigma-Aldrich, ST Louis, MO, USA) in Phosphatsalzpuffer (1 × PBS) zugegeben Röhrchen (das bereits 2 ml HPG-Lösung und 1 g Erde enthält) und weiter mit maximaler Geschwindigkeit 5 Minuten lang verwirbelt (Vortex-Genie 2, Scientific Industries, Inc., Böhmen, NY, USA), um Zellen vom Boden zu lösen Partikel. Die Kulturröhrchen wurden dann 55 Minuten bei 500 × g zentrifugiert (Zentrifuge 5810R, Eppendorf, Hamburg, Deutschland), und der Überstand, der die abgelösten Zellen enthielt, wurde in 700 & mgr; l-Aliquots aliquotiert und sofort bei –20 ° C in 10% Glycerin (Sigma) eingefroren -Aldrich, ST Louis, MO, USA) bis zur weiteren Verarbeitung in PBS gelöst. Die Menge an Überstand, die pro Aliquot gesammelt wurde, wurde basierend auf vorläufigen Daten ausgewählt, die zeigten, dass diese Menge optimal war, um die Zielanzahl von Zellen stromabwärts zu sortieren. Bestimmung der Hintergrundfluoreszenzmarkierung in BONCAT Wir führten getötete Kontrollexperimente durch, um den aktiven Einbau von HPG und die Fluoreszenzmarkierung durch Zellen durch Fixieren von doppelten Bodenproben aus 76 cm mit 3% Paraformaldehyd (PFA, Sigma-Aldrich, ST Louis MO, USA) zu validieren. für 1 h bei RT. Das Ziel dieses Experiments war es zu bestätigen, dass die Zellen HPG aktiv einbauen mussten, um markiert zu werden, und dass die einfache Diffusion von HPG in Zellen kein artefaktisches Signal 25, 26 erzeugen würde. Tests mit PFA wurden als Kontrollen während der Methodenentwicklung verwendet, und alle Sequenzierungsergebnisse und wurden aus einer nicht fixierten Probe erzeugt. Wir führten die PFA-Fixierung (PFA, Sigma-Aldrich, ST Louis MO, USA) entweder vor oder unmittelbar nach der Inkubation mit HPG durch. Ein Satz von Proben wurde zuerst 1 h bei RT mit 3% Paraformaldehyd fixiert, während für einen anderen Satz PFA nach der Inkubation versetzt wurde. Die Details der Inkubationsbedingungen sind in der Ergänzungstabelle 2 zu finden. Diese getöteten Kontrollen wurden mit anderen lebenden Kontrollen verglichen, die ohne HPG inkubiert wurden, um die unspezifische Fluoreszenzmarkierung von Zellen zu messen. Die getöteten Kontrollen und die Kontrollen ohne HPG durchliefen die Klick-Chemie-Reaktion (siehe unten) und ihre Fluoreszenz im BONCAT-Farbstoffkanal wurde gemessen, um die Hintergrundfluoreszenz der Proben zu bestimmen. Die Inkubationszeiten betrugen 2 h und 48 h. Dieser Probensatz wurde wie zuvor beschrieben behandelt, die Zellen wurden vom Boden abgelöst und die gefrorene Brühe in 10% Glycerin wurde bis zur weiteren Bewertung des HPG-Einbaus bei –20 ° C gehalten, siehe unten. Bodeneigenschaften, mineralische und organische Zusammensetzung der Böden Zur Analyse der mineralogischen Zusammensetzung der Bodenkerne wurde die Röntgenpulverbeugung verwendet. Pulverförmige Proben wurden auf einen Autosampler in einem Rigaku SmartLab-Röntgendiffraktometer (Rigaku, The Woodlands, TX, USA) unter Verwendung einer Bragg-Brentano-Geometrie in einer Theta-Theta-Konfiguration geladen. Daten wurden von 4 ° bis 70 ° von 2 & thgr; unter Verwendung von Cu K & agr; -Strahlung gesammelt. Nach manueller Identifizierung der vorhandenen Phasen wurde eine Rietveld-Verfeinerung durchgeführt, um ihre Gewichtsanteile unter Verwendung der Software MAUD 40 zu erhalten. Die bodenchemischen Analysen wurden vom UC Davis Analytical Lab () durchgeführt. Der Gesamtkohlenstoff und der Gesamtstickstoff wurden nach der Verbrennungsmethode gemessen, wie sie nach der offiziellen AOAC-Methode 272 beschrieben ist. 43. Der TOC wurde nach Entfernung des Carbonats durch Säurebegasung auf die gleiche Weise gemessen. 41. Bodennitrat und extrahierbares Ammonium wurden mit dem Durchflussinjektionsanalysator bestimmt Methode 42, 43. Das extrahierbare Phosphat (unter einer Nachweisgrenze von 1 ppm für unsere Proben) wurde mit der Olsen-P-Methode 44 gemessen. Diese Methode misst das bioverfügbare anorganische Phosphat (Orthophosphat). Klickreaktion - BONCAT-Färbung Ein Volumen von 700 & mgr; l gefrorener Zellen jeder Probe wurde ~ 1 h bei 4 ° C auftauen gelassen. In der Zwischenzeit wurde das Klick-Reaktionsgemisch durch Mischen der Farbstoffvormischung mit dem Reaktionspuffer hergestellt. Diese Vormischung bestand aus 5 ul Kupfersulfat (CuSO 4 100 uM Endkonzentration), 10 ul Tris-Hydroxypropyltriazolylmethylamin (THPTA, 500 uM Endkonzentration) und 3,3 ul (FAM-Picolylazidfarbstoff, 5 uM Endkonzentration). Das Gemisch wurde 3 min im Dunkeln inkubiert, bevor es mit dem Reaktionspuffer gemischt wurde, der aus 50 & mgr; l Natriumascorbat, hergestellt frisch in 1 × PBS bei 5 mM Endkonzentration, und 50 & mgr; l Aminoguanidin-HCl, frisch hergestellt in 1 × PBS bei 5 mM Endkonzentration, hergestellt wurde Konzentration und 880 µl 1X PBS. Alle Reagenzien wurden von Click Chemistry Tools (Click Chemistry Tools, Scottsdale, AZ, USA) gekauft. Nach dem Auftauen wurden die Zellen auf einem 0,2 & mgr; m GTTP-Isopore ™ -Filter mit 25 mm Durchmesser (MilliporeSigma, Burlington, MA, USA) eingefangen und mit 7 ml 1 × PBS gespült. Der Filter wurde dann auf einen Objektträger gelegt und 80 ul der Klickreaktionsmischung wurden schnell zugegeben, bevor der Filter mit einem Deckglas bedeckt wurde, um überschüssigen Sauerstoff während der Klickreaktion zu vermeiden. Die Objektträger wurden 30 min im Dunkeln inkubiert und jeder Filter wurde dann dreimal in einer Folge von drei Bädern von 20 ml 1 × PBS jeweils 5 min gründlich gewaschen. Die Filter wurden schließlich in 5-ml-Röhrchen (BD-Falcon 5-ml-Rundbodenröhrchen mit Schnappverschluss, Corning TM, Corning, NY, USA) mit 2 ml 0,02% Tween® 20 in PBS mit den Zellen nach innen überführt und 5 min bei maximaler Geschwindigkeit verwirbelt, um die Zellen abzutrennen. Die Röhrchen wurden 20 min bei 25 ° C inkubiert und anschließend bei 4 ° C gelagert. Vor dem Laden auf den Zellsortierer (BD-Influx TM, BD Biosciences, San Jose, CA, USA) wurden die Proben durch ein 35 & mgr; m-Filter (BD-Falcon 5 ml-Röhrchen mit Zellsiebkappe, Corning TM, Corning, filtriert). NY, USA). Jeder Satz von Experimenten umfasste mit Wasser inkubierte Proben (Wasser-HPG-Kontrolle), die zusammen mit jedem Satz von Proben angeklickt wurden. Die Fluoreszenz der mit Wasser inkubierten Proben im BONCAT-Farbstoffkanal wurde verwendet, um den BONCAT-Färbungshintergrund jeder einzelnen Klickreaktion zu definieren. Durchflusszytometer, Zellzahl und Zellsortierung Für die Zellzahlen wurden die Zellen genauso wie oben beschrieben hergestellt, jedoch wurde die Klickreaktion weggelassen und die vom Boden abgelösten Zellen wurden 1 × SYBR TM (ThermoFisher Scientific, Invitrogen, Eugene OR, USA). Zur Auswertung der BONCAT-gefärbten Proben wurden die Zellen mit dem DNA-Farbstoff SYTO TM 59 (ThermoFisher Scientific, Invitrogen, Eugene OR, USA) 5 min bei RT bei 0,5 uM gegengefärbt. Der Zellsortierer (BD-Influx TM, BD Biosciences, San Jose, CA, USA) wurde eingerichtet, um den FAM-Picolylazidfarbstoff (Anregung = 490 nm / Emission = 510 nm) im grünen Kanal von einem 488 nm blauen Laser und einzufangen die Gegen-DNA-Färbung (Anregung = 622 nm, Emission = 645 nm) im roten Kanal eines 630 nm roten Lasers. Ein erstes Gate wurde auf die SYTO-positiven (SYTO +) Partikel gezeichnet, unter der Annahme, dass dies die Zellen einfangen würde. SYTO + -Ereignisse machten je nach Probe 0–5% der Ereignisse aus, wobei die meisten Ereignisse abiotisch waren, höchstwahrscheinlich Tone oder andere Mineralien (ergänzende Abb. Die BONCAT-positiven (BONCAT +) und BONCAT-negativen (BONCAT−), wo weiter als Teilfraktion der SYTO + -Zellen basierend auf der BONCAT-Farbstofffluoreszenz untersucht. Die Nicht-HPG-Kontrollprobe, die zusammen mit den markierten Proben Klickreaktionsschritte durchlief, wurde verwendet, um den Grad der Hintergrund-BONCAT-Färbungsfluoreszenz zu definieren, das BONCAT-Gate Unter dieser Linie und dem BONCAT + -Tor gezeichnet, um weniger als 0,5% falsch positive Ergebnisse zu gewährleisten (Abb. 1b). Der Prozentsatz von BONCAT +, der für einen Zeitverlauf sowohl für die 30-cm- als auch für die 76-cm-Probe bestimmt wurde, leitete die Sortierentscheidungen Sortieren Sie drei biologische Replikate zu zwei Inkubationszeitpunkten für die 76-cm-Probe (2 h und 48 h) und drei biologische Replikate zu einem Zeitpunkt für die 30-cm-Probe (48 h).Insgesamt 35–75 k Zellen (die Zielzahl war 75 k, aber einige Proben hatten zu niedrige Zellzahlen oder zu niedrige markierte Zellzahlen, siehe ergänzende Tabelle 1 für detaillierte Zählungen) wurden parallel für die BONCAT + - und BONCAT− -Gates in sortiert eine 96-Well-Platte. Die Platten wurden bis zur Verarbeitung bei –80 ° C eingefroren. Gesamt-DNA-Extraktion aus Boden und Filtern Um sortierte Zellen mit dem Bodenmikrobiom zu vergleichen, wurde aus den Bodenkernen insgesamt gereinigte DNA hergestellt und die extrahierbaren Zellen auf einem 0,2 GTTP Isopore ™ 25 mm-Filter (MilliporeSigma, Burlington, MA, USA). Wir verwendeten das Qiagen-MoBio Power-Boden-DNA-Kit (Qiagen, Hilden, Deutschland) gemäß den Anweisungen des Herstellers, mit Ausnahme des Lyse-Schritts, der durch 10-minütiges Schütteln der Röhrchen bei 30 Hz in einem Gewebehomogenisator (TissueLyser II, Qiagen, durchgeführt wurde). Hilden, Deutschland). Vorbereitung und Sequenzierung der Bibliotheken Um die sortierten Zellen zu pelletieren, wurden die 96-Well-Platten 60 Minuten bei 7200 × g und 10 ° C zentrifugiert. Die Platten wurden 20 s bei 60 × g kopfüber weiter zentrifugiert, um den Überstand zu entfernen. Die pelletierten Zellen wurden unter Verwendung der chemischen Lyse von PrepGEM (zyGEM, Charlottesville, VA, USA) in 2 & mgr; l-Reaktionen gemäß den Empfehlungen des Herstellers lysiert. In jede Vertiefung wurden 0,2 ul 10 × grüner Puffer, 0,02 ul PrepGEM, 0,02 ul Lysozym und 1,8 ul Wasser gegeben. Beachten Sie, dass sechs leere Vertiefungen der PrepGEM-Lyse und dem Bibliotheksbau unterzogen wurden, um mögliche Verunreinigungen zu berücksichtigen. Die Platten wurden dann 30 Minuten bei 37 ° C und 30 Minuten bei 75 ° C in einen Thermocycler gegeben. Die iTag-PCR wurde direkt am Zelllysat gemäß dem JGI-Standard-Betriebsprotokoll durchgeführt (). Kurz gesagt wurde die V4-Region des 16S-rRNA-Gens unter Verwendung des universellen Primer-Sets 515F (GTGYCAGCMGCCGCGGTAA), 806R (GGACTACNVGGGTWTCTAAT) 45 amplifiziert. Die Adaptersequenzen, Linker und der Barcode befanden sich auf dem Reverse-Primer. Die 16S-rRNA-Gen-PCR wurde in einem Endvolumen von 25 & mgr; l (10 & mgr; l des 5-Prime-Master-Mix, 0,5 & mgr; l des Vorwärtsprimers (bei 10 & mgr; M), 1,5 & mgr; l des Rückwärtsprimers (bei 3) durchgeführt. 3 uM), 0,44 ul BSA, 10,5 ul Wasser und 2 ul Zelllysat). Die PCR-Bedingung war wie folgt: Nach einem anfänglichen Denaturierungsschritt bei 94 ° C für 3 Minuten traten 30 PCR-Zyklen auf, die aus einem 45-s-Denaturierungsschritt bei 94 ° C bestanden, gefolgt von einem 1-minütigen Annealing-Schritt bei 50 ° C und einem 1. 5 min Dehnungsschritt bei 72 ° C. Ein letzter Dehnungsschritt von 10 min bei 72 ° C wurde weiter hinzugefügt, um alle unvollständigen Zielsequenzen zu beenden. Die V4-Region des 16S-rRNA-Gens aus der aus dem Boden extrahierten Gesamt-DNA und aus den an Filtern angereicherten Zellen wurde ebenfalls unter Verwendung der gleichen PCR-Bedingung amplifiziert. Die PCR-Produkte wurden unter Verwendung der Agencourt AMpure XP-Kügelchenlösung (Beckman Coulter Life Sciences, Indianapolis, IN, USA) gereinigt, um überschüssige Primer und Primerdimere zu entfernen. PCR-Produkte wurden mit 80% (v / v) Kügelchen 5 Minuten bei 25 ° C inkubiert, bevor sie auf einen Magnethalter (MagWell TM Magnetic Separator 96, EdgeBio, San Jose, CA, USA) gelegt wurden. Der Überstand wurde entfernt und die Perlen wurden dreimal mit 70% v / v Ethanol gewaschen, bevor sie in 11 ul Wasser resuspendiert wurden. Die gesamten DNA-Extrakte wurden parallel verarbeitet, wobei der einzige Unterschied darin bestand, dass die iTag-PCR in einem Endvolumen von 50 & mgr; l durchgeführt wurde und das PCR-Produkt nach dem Perlenreinigungsschritt in 16 & mgr; l Wasser resuspendiert wurde. PCR-Produkte wurden auf einem hochempfindlichen DNA-Assay-Bioanalyzer-Chip (2100 Bioanalyser, Agilent, Santa Clara, CA, USA) laufen gelassen, um die Fragmentgröße und -konzentration zu bestätigen. PCR-Produkte wurden auf eine äquimolare Konzentration gepoolt und auf der Illumina MiSeq-Plattform (Illumina, San Diego, CA, USA) laufen gelassen. Sequenzdaten wurden unter der Bioprojekt-ID PRJNA475109 am NCBI archiviert. Sequenzverarbeitung Die Sequenzen wurden mit Qiime2 v2017 verarbeitet. 9 46. Die Sequenzen wurden in qiime2 im Fastq-Manifest-Format importiert. Die Sequenzen wurden weiter entrauscht, der Primer getrimmt (20 Nukleotide von jeder Seite) und unter Verwendung von DADA2 47 gepaart, wie in dem Qiime dada2-Denoise-Paired-Plug-In implementiert. Dieser Schritt beinhaltete auch eine Chimärenprüfung unter Verwendung der Konsensmethode. Die Ausgabe war eine Tabelle mit 4063 Merkmalen (auch als exakte Sequenzvariante (ESV) bezeichnet) von 6, 419, 059 Sequenzen. 130 Features hatten mindestens einen Treffer in einem der sechs Kontrollen ohne Vorlage und wurden für die weitere Analyse nicht berücksichtigt. Die gefilterte Tabelle hatte 6, 110, 776 Sequenzen, die in 3933 Merkmalen mit einem Medianwert von 205, 167 Sequenzen pro Probe zusammengefasst waren. Die Funktionen wurden unter Verwendung des Plug-Ins vsearch cluster-features-de-novo mit einer Ähnlichkeit von 97% zu operativen taxonomischen Einheiten (OTUs) zusammengefasst. Die gruppierte OTU-Tabelle hatte insgesamt 1533 OTUs. Die absolute Anzahl von OTUs in 16S-rRNA-Genanalysen kann je nach verwendeter Technik um bis zu drei Größenordnungen variieren 48. DADA2 liefert bekanntermaßen eine konservativere Anzahl als die zuvor weit verbreiteten Upfront-Clustering-Methoden, indem die Anzahl falsch positiver Ergebnisse verringert wird 47. Diese relativ niedrige OTU-Zahl steht auch im Einklang mit dem sehr geringen Gehalt an organischen Stoffen (Kohlenstoff und Stickstoff) in diesen Böden, deren gesamter organischer Kohlenstoff (TOC) mit nicht besiedelten ariden Gebieten vergleichbar ist, in denen die mikrobielle Vielfalt bekanntermaßen verringert ist 49 Die Taxonomie der repräsentativen Sequenzen wurde mit dem Feature-Classifier classify-sklearn Plug-In () zugewiesen. Dieser Klassifikator wurde in der Greengenes-Datenbank 13_8 trainiert, die zu 99% auf die amplifizierte Region (V4 515F / 806R) zugeschnitten war. Wenn der Klassifizierer die repräsentativen Sequenzen am Stamm nicht zuordnen konnte, wurden sie manuell auf dem aktuellsten Silva SINA-Ausrichtungsdienst () überprüft, und die Silva-Klassifizierung wurde beibehalten. Die OTU-Tabelle mit zugewiesener Taxonomie wurde verwendet, um das Balkendiagramm auf Phylum-Ebene und alle nachgeschalteten Analysen zu erstellen. Die Beta-Diversity-Metrik für den paarweisen Abstand von Bray Curtis wurde auf der OTU-Tabelle berechnet und die erhaltene dreieckige Abstandsmatrix wurde unter Verwendung von NMDS ordiniert. Die OTU-Tabelle wurde weiter auf eine gleichmäßige Sequenztiefe von 81.000 verdünnt, die verdünnte OTU-Tabelle wurde verwendet, um das Diagramm der Ranghäufigkeit zu erstellen. OTUs in jeder Bibliothek wurden nach ihrer Häufigkeit unter Verwendung der Durchschnittsmethode sortiert, wobei eine Gruppe ähnlicher Werte den durchschnittlichen Rangwert für die Gruppe erhält; Die Häufigkeit wurde in logarithmischer Skala gegen den logarithmischen Rangwert in absteigender Reihenfolge aufgetragen. Vergleich mit dem Referenzdatensatz Wir verglichen unsere iTag-Daten mit dem 697-16S-rRNA-Gen in voller Länge der vorhandenen Kultursammlung des ENIGMA-Projekts von diesem Feldstandort und mit den 511 16S-rRNA-Gensequenzen der am häufigsten vorkommenden und am weitesten verbreiteten Bodenmikrobiom-Mitglieder, die aus Delgado stammen -Baquerizo et al. 29. Wir führten einen Nucleotid-BLAST mit einer repräsentativen Sequenz pro Merkmal gegen die ENIGMA-Isolatdatenbank oder die Datenbank „511 meistgesuchte Bodenphylotypen“ 29 unter Verwendung von Geneious R9 © durch. Ein Cutoff von> 97% Ähnlichkeit wurde verwendet, um zu bestimmen, ob eine Sequenz aus unserem Datensatz mit der ENIGMA-Isolatdatenbank und / oder der Datenbank „511 meistgesuchte Bodenphylotypen“ übereinstimmt. LC-MS-Bodenmetabolomik Dreifach von 2 g Böden aus 30 cm und 70 cm wurden unter Verwendung von 8 ml Wasser von LCMS-Qualität extrahiert und 1 h auf einem Überkopfschüttler bei 4 ° C inkubiert. Wässrige extrahierbare Komponenten wurden durch Entfernen von unlöslichem Material durch Zentrifugation bei 3220 × g für 15 Minuten bei 4 ° C, Filtration von Überständen durch einen 0,45 & mgr; m PVDF-Spritzenfilter (MilliporeSigma, Burlington, MA, USA) und anschließende Gefriertrocknung von gesammelt Filtrate zur Entfernung von Wasser (Labconco 7670521, Kansas City, MO, USA). Getrocknete Proben wurden dann in 500 & mgr; l Methanol von LCMS-Qualität resuspendiert, 15 Minuten bei 25 ° C im Bad beschallt und dann durch Filtration durch 0,2 & mgr; m PVDF-Mikrozentrifugalfiltrationsvorrichtungen (1000 × g, 2 min, 25 ° C) geklärt. Methanolextrakte wurden mit einer internen Standardmischung (13 C, 15 N universell markierte Aminosäuren, 767964, Sigma-Aldrich, USA, versetzt, die kanonische Aminosäuren, einschließlich Methionin, in einer Endkonzentration von jeweils 10 uM enthielt) versetzt. Metaboliten in Extrakten wurden unter Verwendung einer hydrophilen Flüssigkeitswechselwirkungschromatographie auf einer SeQuant 5 & mgr; m, 150 × 2,1 mm, 200 Å zic-HILIC-Säule (1. 50454. 0001, Millipore) chromatographisch getrennt und mit einer Q Exactive Hybrid Quadrupol-Orbitrap-Masse nachgewiesen Spektrometer mit einer HESI-II-Quellensonde (ThermoFisher Scientific). Chromatographische Trennungen wurden mit einem HPLC-System der Agilent 1290-Serie durchgeführt, das mit einer Säulentemperatur von 40 ° C verwendet wurde. Die Probenlagerung wurde auf 4 ° C und das Injektionsvolumen auf 6 & mgr; l eingestellt. Ein Gradient der mobilen Phase A (5 mM Ammoniumacetat in Wasser) und B (5 mM Ammoniumacetat, 95% v / v Acetonitril in Wasser) wurde zur Metabolitenretention und -elution wie folgt verwendet: Säulenäquilibrierung bei 0,45 ml 4 5 ml min –1 in 100% B für 1,5 min, gefolgt von einem linearen Gradienten bei 0,55 ml min –1 bis 35% A über 13,5 min, einem linearen Gradienten auf 0,6 ml 5 ml min –1 und auf 100% A über 3 min, Halten bei 0,6 6 5 ml min –1 und 100% A für 5 min, gefolgt von einem linearen Gradienten auf 0,45 5 ml min –1 und 100% B über 2 min und Reäquilibrierung für weitere 7 min. Jede Probe wurde zweimal injiziert: einmal zur Analyse im Positivionenmodus und einmal zur Analyse im Negativionenmodus. Die Massenspektrometerquelle wurde mit einem Mantelgasstrom von 55, einem Hilfsgasstrom von 20 und einem Spülgasstrom von 2 (willkürliche Einheiten) und einer Sprühspannung von | ± 3 | eingestellt kV und Kapillartemperatur von 400 ° C. Ionen wurden mit der datenabhängigen MS2 Top2-Methode von Q Exactive nachgewiesen, wobei die beiden vorläufigen Ionen mit der höchsten Häufigkeit (2,0 m / z-Isolationsfenster, 17, 500 Auflösung, 1e5 AGC-Ziel, 2,0 m / z-Isolationsfenster, schrittweise normalisiert) nachgewiesen wurden Kollisionsenergien von 10, 20 und 30 eV) ausgewählt aus einem vollständigen MS-Pre-Scan (70–1050 m / z, 70.000 Auflösung, 3e6 AGC-Ziel, 100 ms maximale Ionenübertragung) mit dd-Einstellungen bei 1e3 minimalem AGC-Ziel; oben ausgeschlossene Gebühren | 3 | und ein dynamisches Ausschlussfenster von 10 s. Zu Qualitätskontrollzwecken wurden interne und externe Standards aufgenommen, wobei zwischen jeder einzelnen Probe Blindinjektionen durchgeführt wurden. Das QC-Gemisch wurde zu Beginn und am Ende der Injektionssequenz injiziert, um die Stabilität des Signals über die Zeit sicherzustellen, und bestand aus 30 Verbindungen, die einen großen Bereich von m / z, RT überspannten und sowohl im positiven als auch im negativen Modus nachweisbar waren. Extrahierte Ionenchromatogramme für interne Standardverbindungen wurden unter Verwendung von MZmine Version 2 ausgewertet. 26 50, um die Konsistenz zwischen den Injektionen sicherzustellen. Die Proben wurden mit Metabolite Atlas 50 () analysiert. Kurz gesagt wurde eine durch Retentionszeit korrigierte Verbindungsbibliothek, die durch linearen Regressionsvergleich von QC-Standards mit einer internen Retentionszeit (RT) - m / z-MSMS-Bibliothek von Referenzverbindungen erzeugt wurde, die unter Verwendung der gleichen LCMS-Methoden analysiert wurden, zur Identifizierung der Verbindung in Proben verwendet, in denen gemessen wurde RT-, m / z- und Fragmentierungsspektren wurden mit von der Bibliothek vorhergesagter RT, theoretischem m / z, von der Bibliothek detektierten Addukten und Bibliotheks-MSMS-Fragmentierungsspektren verglichen. Die Identifizierung der Verbindungen wurde beibehalten, wenn die Peakintensität> 1e4 war, der Unterschied der Retentionszeit gegenüber dem vorhergesagten <1 min war, m / z <20 ppm vom theoretischen Wert betrug, das erwartete Addukt nachgewiesen wurde und mindestens ein Ionenfragment mit den Bibliotheksspektren übereinstimmte und häufiger vorkam mindestens eine Probe im Vergleich zum Mittelwert + 1 SD der Extraktionskontrollen. Nur acht Verbindungen erfüllten diese Kriterien; Die durchschnittlichen Peakhöhen aus den extrahierten Ionenchromatogrammen sind in Abb. S5 angegeben. Das Signal war aufgrund der geringen Menge an organischen Stoffen in diesen Böden insgesamt sehr niedrig. Wir überprüften das Vorhandensein von Methionin manuell mit MZmine Version 2. 26 32 und bestätigten, dass in keiner der analysierten Proben eine nachweisbare Menge Methionin vorhanden war. Metabolomics-Daten wurden zusammen mit der Analysedatei Nr. 1207417 im JGI-Genomportal Nr. 1207416 hinterlegt. Ergänzende Informationen Danksagung Die Autoren danken Dominique Joyner für die Probenentnahme und den Versand, Marco Voltolini (LBNL) für seine Unterstützung bei den Röntgenbeugungsanalysen, Michael Thorgersen (LBNL) und Mike W. Adams (LBNL) für die gemeinsame Nutzung der 16S-rRNA-Gensequenz des Isolats MT58RC und der JGI-Sequenzierungsgruppe für seine technische Unterstützung. Diese Arbeit wurde durch einen Entdeckungsvorschlag finanziert, der T. Northen im Rahmen des ENIGMA Science Focus Area verliehen wurde, der vom Genomic Sciences Program, Büro für biologische und Umweltforschung, Department of Energy Office of Science, finanziert wird. Die Arbeit des Joint Genome Institute des US-Energieministeriums, einer Nutzereinrichtung des DOE Office of Science, wird vom Office of Science des US-Energieministeriums unter der Vertragsnummer DE-AC02-05CH11231 unterstützt. Autorenbeiträge E. C., R. R. M. und T. N. entwarfen das Experiment, sammelten und analysierten Daten und verfassten das Manuskript. J. entwarf das Experiment, erfasste und analysierte Daten. D. G. entwarf das Experiment und betrieb das FACS. vorbereitete Bibliotheken für die Sequenzierung. T. C. H. lieferte Proben. B. P. unterstützte die Datenanalyse. gemeinsame Daten aus der ENIGMA-Kultursammlung. Alle Autoren gaben Feedback zum Manuskript. Datenverfügbarkeit Die 16S-rRNA-Gensequenzen aus den für diese Studie konstruierten Bibliotheken wurden unter der Bioprojekt-ID PRJNA475109 [] bei Genebank hinterlegt. Die 16S-rRNA-Gene aus der ENIGMA-Kultursammlung sind in den ergänzenden Daten 1 enthalten. Die gesammelten rohen Durchflusszytometerdaten sind in den ergänzenden Fig. 1 und 2 dargestellt. 4 und 5. Die LCMS-Daten und -Analysen sind auf dem Genomportal des Joint Genome Institute öffentlich verfügbar:. Die Datendatei ist # 1207416 und die Analysedatei ist # 1207417. Quelldaten für die Fign. 1c, d, 2b, 3 und 4 und ergänzende Fign. 1b und 2c werden als Quelldatendatei bereitgestellt. Konkurrierende Interessen Die Autoren erklären keine konkurrierenden Interessen. Fußnoten Peer-Review-Informationen: Nature Communications dankt den anonymen Rezensenten für ihren Beitrag zur Begutachtung dieser Arbeit. Anmerkung des Herausgebers: Springer Nature bleibt hinsichtlich der Zuständigkeitsansprüche in veröffentlichten Karten und institutionellen Zugehörigkeiten neutral. Ergänzende Informationen Ergänzende Informationen liegen diesem Dokument unter 10. 1038 / s41467-019-10542-0 bei. Referenzen 1. Bardgett RD, Van Der Putten WH. Unterirdische Biodiversität und Funktionieren des Ökosystems. Natur. 2014; 515: 505–511. doi: 10. 1038 / nature13855. [PubMed] [CrossRef] [Google Scholar] 2. Torsvik V, Øvreås Å. Mikrobielle Vielfalt und Funktion im Boden: von Genen zu Ökosystemen. Curr. Op. Microbiol. 2002; 5: 240–245. 1016 / S1369-5274 (02) 00324-7. [PubMed] [CrossRef] [Google Scholar] 3. Fierer N. Das Unbekannte umarmen: Die Komplexität des Bodenmikrobioms entwirren. Nat. Rev. 2017; 15: 579–590. 1038 / nrmicro. 2017. 87. [PubMed] [CrossRef] [Google Scholar] 4. Schloss PD, Handelsman J. Auf dem Weg zu einer Bakterienzählung im Boden. PLoS Comput. Biol. 2006; 2: 0786–0793. 1371 / [PMC-freier Artikel] [PubMed] [CrossRef] [Google Scholar] 5. Fierer N., Bradford MA, Jackson RB. Auf dem Weg zu einer ökologischen Klassifizierung von Bodenbakterien. Ökologie. 2007; 88: 1354–1364. 1890 / 05-1839. [PubMed] [CrossRef] [Google Scholar] 6. Ramirez KS, et al. Erkennung makroökologischer Muster in Bakteriengemeinschaften in unabhängigen Studien globaler Böden. 2017; 3: 1–8. [PubMed] [Google Scholar] 7. Fierer N, Jackson R. Die Vielfalt und Biogeographie von Bodenbakteriengemeinschaften. Proc. Natl Acad. Sci. USA. 2006; 103: 626–631. 1073 / pnas. 0507535103. [PMC-freier Artikel] [PubMed] [CrossRef] [Google Scholar] 8. Crowther TW, et al. Vorhersage der Reaktionsfähigkeit der biologischen Vielfalt des Bodens auf Entwaldung: eine Cross-Biom-Studie. Glob. Chang. 2014; 20: 2983–2994. 1111 / gcb. 12565. [PubMed] [CrossRef] [Google Scholar] 9. Serna-Chavez HM, Fierer N., Van Bodegom PM. Globale Treiber und Muster der mikrobiellen Häufigkeit im Boden. Ecol. Biogeogr. 2013; 22: 1162–1172. 1111 / geb. 12070. [CrossRef] [Google Scholar] 10. Barberán A, Bates ST, Casamayor EO, ​​Fierer N. Verwenden der Netzwerkanalyse zur Untersuchung von Koexistenzmustern in mikrobiellen Gemeinschaften im Boden. ISME J. 2012; 6: 343–351. 1038 / ismej. 2011. 119. [PMC-freier Artikel] [PubMed] [CrossRef] [Google Scholar] 11. Carini P, et al. Relikt-DNA ist im Boden reichlich vorhanden und verdeckt Schätzungen der mikrobiellen Vielfalt des Bodens. 2016; 2: 1–6. [PubMed] [Google Scholar] 12. Blagodatskaya E, Kuzyakov Y. Aktive Mikroorganismen im Boden: Kritische Überprüfung der Schätzkriterien und -ansätze. Boden Biol. Biochem. 2013; 67: 192–211. 1016 / ilbio. 2013. 08. 024. [CrossRef] [Google Scholar] 13. Jones SE, Lennon JT. Die Ruhephase trägt zur Erhaltung der mikrobiellen Vielfalt bei. 2010; 107: 5881–5886. 0912765107. [PMC-freier Artikel] [PubMed] [CrossRef] [Google Scholar] 14. Lennon JT, Jones SE. Mikrobielle Samenbanken: die ökologischen und evolutionären Auswirkungen der Ruhephase. Publ. GR. 2011; 9: 119–130. [PubMed] [Google Scholar] 15. Sänger E, Wagner M, Woyke T. Erfassung des Erbguts des aktiven Mikrobioms in situ. 2017; 11: 1949–1963. 59. [PMC-freier Artikel] [PubMed] [CrossRef] [Google Scholar] 16. Pett-Ridge J, Firestone MK. Verwendung stabiler Isotope zur Untersuchung der Wechselwirkungen zwischen Wurzel, Mikrobe und Mineral im Boden. Rhizosphäre. 2017; 3: 244–253. 1016 / [CrossRef] [Google Scholar] 17. Verastegui Y, Cheng J, Engel K. Multisubstrat-Isotopenmarkierung und metagenomische Analyse aktiver Bodenbakteriengemeinschaften. MBio. 2014; 5: 1–12. 1128 / mBio. 01157-14. [PMC-freier Artikel] [PubMed] [CrossRef] [Google Scholar] 18. Neufeld JD, et al. DNA-Stabilisotopensuche. Protoc. 2007; 2: 860–866. 1038 / nprot. 2007. 109. [PubMed] [CrossRef] [Google Scholar] 19. Jameson Eleanor, Taubert Martin, Coyotzi Sara, Chen Yin, Eyice Özge, Schäfer Hendrik, Murrell J. Colin, Neufeld Josh D., Dumont Marc G. Methoden in Molekularbiologie. New York, NY: Springer New York; 2016. DNA-, RNA- und Protein-basierte Stabilisotopensuche für die Hochdurchsatz-Biomarker-Analyse aktiver Mikroorganismen; S. 57–74. [PubMed] [Google Scholar] 20. Artursson V, Jansson JK. Verwendung der Bromdeoxyuridin-Immunabscheidung zur Identifizierung aktiver Bakterien, die mit arbuskulären Mykorrhizahyphen assoziiert sind. Gesellschaft. 2003; 69: 6208–6215. [PMC-freier Artikel] [PubMed] [Google Scholar] 21. David MM, et al. Mikrobielle Ökologie des biologischen Abbaus chlorierter Lösungsmittel. Environ. 2015; 17: 4835–4850. 1111 / 1462-2920. 12413. [PubMed] [CrossRef] [Google Scholar] 22. Bravo D, et al. Identifizierung aktiver oxalotropher Bakterien durch Bromdeoxyuridin-DNA-Markierung in Mikrokosmos-Bodenexperimenten. FEMS Microbiol. Lette. 2013; 348: 103–111. 1111 / 1574-6968. 12244. [PubMed] [CrossRef] [Google Scholar] 23. Eichorst SA, et al. Fortschritte bei der Anwendung der NanoSIMS- und Raman-Mikrospektroskopie zur Untersuchung der Aktivität mikrobieller Zellen in Böden. 2015; 91: 1–14. 1093 / femsec / fiv106. [PMC-freier Artikel] [PubMed] [CrossRef] [Google Scholar] 24. Berry D, et al.Verfolgung des Einbaus von schwerem Wasser (D 2 O) zur Identifizierung und Sortierung aktiver mikrobieller Zellen. 2015; 112: E194 - E203. 1420406112. [PMC-freier Artikel] [PubMed] [CrossRef] [Google Scholar] 25. Hatzenpichler R, et al. In-situ-Visualisierung neu synthetisierter Proteine ​​in Umweltmikroben mittels Aminosäure-Tagging und Klick-Chemie. 2014; 16: 2568–2590. 12436. [PMC-freier Artikel] [PubMed] [CrossRef] [Google Scholar] 26. Visualisierung der In-situ-Translationsaktivität zur Identifizierung und Sortierung langsam wachsender archaeal-bakterieller Konsortien. 2016; 113: E4069 - E4078. 1603757113. [PMC-freier Artikel] [PubMed] [CrossRef] [Google Scholar] 27. Dieterich DC, Link AJ, Graumann J, Tirrell DA, Schuman EM. Selektive Identifizierung neu synthetisierter Proteine ​​in Säugetierzellen mittels bioorthogonaler nichtkanonischer Aminosäuremarkierung (BONCAT) Proc. 2006; 103: 9482–9487. 0601637103. [PMC-freier Artikel] [PubMed] [CrossRef] [Google Scholar] 28. Hatzenpichler, R. & Orphan, V. In Protokollen zur Kohlenwasserstoff- und Lipidmikrobiologie - Springer Protocols Handbooks 1–29, 10. 1007/8623 (2015) . Delgado-baquerizo M et al. Ein globaler Atlas der dominanten Bakterien im Boden. Wissenschaft. 2018; 325: 320–325. 1126 / Wissenschaft. aap9516. [PubMed] [CrossRef] [Google Scholar] 30. De Giorgi C., Finetti Sialer M., Lamberti F. Formalin-induzierte Untreue in PCR-amplifizierten DNA-Fragmenten. Mol. Zelle. Sonden. 1994; 8: 459–462. 1006 / mcpr. 1994. 1065. [PubMed] [CrossRef] [Google Scholar] 31. Hansen MC, Tolker-Nielsen T., Givskov M., Molin S. Voreingenommene 16S-rDNA-PCR-Amplifikation, verursacht durch Interferenz durch DNA, die die Matrizenregion flankiert. 1998; 26: 141–149. 1111 / j. 1574-6941. 1998. tb00500. x. [CrossRef] [Google Scholar] 32. Bambauer A, Rainey FA, ​​Stackebrandt E, Winter J. Charakterisierung von Aquamicrobium defluvii gen. nov. sp. nov., ein Thiophen-2-carboxylat-metabolisierendes Bakterium aus Belebtschlamm. Bogen. 1998; 169: 293–302. 1007 / s002030050575. [PubMed] [CrossRef] [Google Scholar] 33. Kampfer P., Martin E., Lodders N., Jackel U. Übertragung von Defluvibacter lusatiensis auf die Gattung Aquamicrobium als Aquamicrobium lusatiense-Kamm. und Beschreibung von Aquamicrobium. Int. Syst. Evol. 2019; 59: 2468–2470. 1099 / ijs. 008730-0. [PubMed] [CrossRef] [Google Scholar] 34. Miller DN, Bryant JE, Madsen EL, Al MET. Bewertung und Optimierung von DNA-Extraktions- und Reinigungsverfahren für Boden- und Sedimentproben. Appl. 1999; 65: 4715–4724. [PMC-freier Artikel] [PubMed] [Google Scholar] 35. Beraldi-Campesi H., Hartnett HE, Anbar A., ​​Gordon GW, Garcia-Pichel F. Einfluss biologischer Bodenkrusten auf Bodenelementkonzentrationen: Auswirkungen auf die Biogeochemie und als rückverfolgbare Biosignaturen des alten Lebens an Land. Geobiologie. 2009; 7: 348–359. 1472-4669. 2009. 00204. [PubMed] [CrossRef] [Google Scholar] 36. Martin-Laurent F. et al. DNA-Extraktion aus Böden: alte Tendenz für neue Methoden zur Analyse der mikrobiellen Vielfalt DNA-Extraktion aus Böden: alte Tendenz für neue Methoden zur Analyse der mikrobiellen Vielfalt. 2001; 67: 2354–2359. 1128 / AEM. 67. 5. 2354-2359. 2001. [PMC-freier Artikel] [PubMed] [CrossRef] [Google Scholar] 37. Leizeaga A, Estrany M, Forn I, Sebastián M. Verwendung der Klick-Chemie zur Visualisierung von In-situ-Änderungen der Translationsaktivität in planktonischen Meeresbakterien. Vorderseite. 2017; 8: 1–11. 3389 / fmicb. 02360. [PMC-freier Artikel] [PubMed] [CrossRef] [Google Scholar] 38. DNA-Extraktion aus Böden: alte Tendenz für neue Methoden zur Analyse der mikrobiellen Diversität. [PMC-freier Artikel] [PubMed] [CrossRef] [Google Scholar] 39. Smith MB, et al. Natürliche Bakteriengemeinschaften dienen als quantitative geochemische. 2015; 6: 1–13. 00326-15. [PMC-freier Artikel] [PubMed] [CrossRef] [Google Scholar] 40. Lutterotti L., Matthies S., Wenk H. MAUD: Ein benutzerfreundliches Java-Programm zur Materialanalyse mit Beugung. CPD Newsl. 1999; 21: 14-15. [Google Scholar] 41. Harris D., Horwa WR, Van Kessel C. Säuregasung von Böden zur Entfernung von Carbonaten vor der Analyse von organischem Kohlenstoff oder Kohlenstoff-13-Isotopen. Boden Sci. Soc. Am. 2001; 1856: 1853–1856. 2136 / sssaj2001. 1853. [CrossRef] [Google Scholar] 42. Hofer, S. Bestimmung von Ammoniak (Salicylat) in 2 M KCl-Bodenextrakten durch Durchflussinjektionsanalyse. QuikChem Method 12-107-06- (2003). Knepel, K. Bestimmung von Nitrat in 2 M KCl-Bodenextrakten durch Durchflussinjektionsanalyse. QuikChem-Methode 12-107-04-1-B (2003). 44. Olsen, S. & Sommers, L. E. In Methoden der Bodenanalyse: Teil 2. Chemische und mikrobiologische Eigenschaften. Agron. Mongr. 9. 2. Aufl. 403–430 (ASA und SSSA, Madison, WI, 1982). 45. Walters WA et al. PrimerProspector: De-novo-Design und taxonomische Analyse von Strichcode-Polymerase-Kettenreaktionsprimern. Bioinformatik. 2011; 27: 1159–1161. 1093 / bioinformatics / btr087. [PMC-freier Artikel] [PubMed] [CrossRef] [Google Scholar] 46. Bolyen, E. et al. QIIME 2: Reproduzierbare, interaktive, skalierbare und erweiterbare Mikrobiom-Datenwissenschaft. PeerJ Preprints 6, e27295v2 (2018). 47. Callahan BJ et al. DADA2: Hochauflösende Probeninferenz aus Amplikondaten. bioRxiv. 2015; 13: 0–14. [PMC-freier Artikel] [PubMed] [Google Scholar] 48. Flynn JM, Brown EA, Chain FJJ, MacIsaac HJ, Cristescu ME. Auf dem Weg zu einer genauen molekularen Identifizierung von Arten in komplexen Umweltproben: Testen der Leistung von Sequenzfilterungs- und Clustering-Methoden. 2015; 5: 2252–2266. 1002 / ece3. 1497. [PMC-freier Artikel] [PubMed] [CrossRef] [Google Scholar] 49. Bowker Ma, Maestre FT, Escolar C. Biologische Krusten als Modellsystem zur Untersuchung der Beziehung zwischen Biodiversität und Ökosystemfunktion in Böden. 2010; 42: 405–417. 10. 025. [CrossRef] [Google Scholar] 50. Yao Y, et al. Analyse von Metabolomics-Datensätzen mit Hochleistungsrechnern und Metabolitenatlanten. Metaboliten. 2015; 5: 431–442. 3390 / metabo5030431. [PMC-freier Artikel] [PubMed] [CrossRef] [Google Scholar].

Lord Andrew Adonis und drei der führenden britischen Unternehmensorganisationen drängten heute auf dringende Fortschritte bei wichtigen Entscheidungen in den Bereichen Verkehr, Energie, Digital und Wasserinfrastruktur in der Schublade der Regierung. In einer heutigen Erklärung nach den Wahlen forderte der Vorsitzende der unabhängigen Nationalen Infrastrukturkommission die Regierung auf, dafür zu sorgen, dass der Brexit und ein blockiertes Parlament Infrastrukturprojekte, die für die Wettbewerbsfähigkeit und Produktivität Großbritanniens von entscheidender Bedeutung sind, nicht verzögern oder verschieben. Lord Adonis sagte: „Die historische Schwäche Großbritanniens bestand darin, zu wenig in die Infrastruktur zu investieren und einen Stop-Go-Ansatz zu wählen, selbst wenn Entscheidungen im Prinzip getroffen werden. Nichts symbolisiert dies mehr als die langjährige Geschichte des Flughafens Heathrow. Eine dritte Landebahn wurde vor 14 Jahren im Prinzip vereinbart, aber es gab noch keine feste Entscheidung, fortzufahren. "Es macht keinen Sinn zu sagen, dass Großbritannien für die Welt offen ist, wenn man nicht zum und vom Rest der Welt kommt, weil Heathrow voll ist. ” Lord Adonis veröffentlichte eine Liste der „Top 12“ der unmittelbaren Prioritäten, bei denen die Minister im nächsten Jahr rasche Fortschritte erzielen müssen. Dazu gehören HS2, neue Stromerzeugungskapazitäten, digitaler und Breitbandausbau, Crossrail 2, HS3 (der „Crossrail für den Norden“) und die neue Themse-Kreuzung zur Entlastung der M25-Dartford-Kreuzung. Seine Erklärung wird vom Verband der britischen Industrie, den britischen Handelskammern und der Federation of Small Businesses unterstützt. In seiner Rede vor der Institution of Civil Engineers sagte Lord Adonis: „Der Brexit und das blockierte Parlament dürfen nicht dazu führen, dass die wichtigsten Infrastrukturherausforderungen des Landes ins Wanken geraten und sich verzögern. Wir müssen die Entscheidungen über Heathrow, HS2 im Norden Englands, neue Stromerzeugungskapazitäten und radikale Verbesserungen der digitalen Kommunikation vorantreiben, um Arbeitsplätze und Wirtschaftswachstum zu unterstützen. "Die raschen Fortschritte bei diesen 12 wichtigsten Projekten und Prioritäten im nächsten Jahr sind ein Härtetest für das Engagement der Regierung für den" Jobs First Brexit ", für das sich Kanzler Philip Hammond letzte Woche ausgesprochen hat. „All dies wurde im Prinzip vereinbart, erfordert jedoch entschlossene Maßnahmen, um sie im neuen Parlament in Bewegung zu setzen. Sie sollten ganz oben auf den Tabletts der Minister stehen und nicht länger als nötig einen Tag dort verweilen. ” Der Generaldirektor der britischen Handelskammern, Dr. Adam Marshall, sagte: „Große und kleine Infrastrukturprojekte geben Geschäftsgemeinschaften in ganz Großbritannien echtes Vertrauen. Sie „drängen“ zusätzliche Unternehmensinvestitionen, schaffen qualifizierte Arbeitsplätze und unterstützen einen stärkeren wechselseitigen Handel mit Kunden und Lieferanten auf der ganzen Welt. Der bestmögliche Brexit-Deal ist das Papier, auf dem er geschrieben ist, nicht wert, wenn wir nicht über die richtige Infrastruktur verfügen, um das Geschäftswachstum hier zu Hause zu unterstützen. „Aufeinanderfolgende Regierungen haben viel zur Infrastruktur gesagt, aber vergleichsweise wenig geliefert. In einer Zeit des Übergangs und des Wandels sind unsere physische und digitale Konnektivität sowie unsere Energiesicherheit wichtiger als je zuvor. Unternehmen wollen, dass Politiker aller Farben ihre Energie darauf konzentrieren, transformative Infrastrukturprojekte umzusetzen - und Unternehmen wiederum werden Investitionen, Arbeitsplätze und Wohlstand bringen. ” Der stellvertretende Generaldirektor der Konföderation der britischen Industrie, Josh Hardie, sagte: „Im Moment haben wir die einmalige Gelegenheit, das Rückgrat des Vereinigten Königreichs - unsere Infrastruktur - zu verändern und es zum Neid der Welt und unserer internationalen Wettbewerber zu machen. „Aber dies einmal in einer Generation, um einen Eckpfeiler unserer Wirtschaft zu reparieren, kann nur dann ein Erfolg sein, wenn Worte in Taten umgesetzt werden, wenn Stifte abgelegt und Bagger in Betrieb genommen werden. Von Heathrow bis HS2 können wir unseren Weg in eine neue Ära des Wachstums, der Produktivität und des gemeinsamen Wohlstands finden. Daher ist es absolut wichtig, dass die Regierung nicht bremst. „Die Verbesserung unserer Infrastruktur voranzutreiben, ist eine enorme Gelegenheit, Nord und Süd zu überbrücken, die Arterien zu stärken, die die Gemeinden verbinden, die Häuser zu bauen, die die Menschen so dringend brauchen, und ihre oft mühsamen Wege zur Arbeit zu verbessern. Wenn wir das richtig machen, stehen wir kurz vor dem Beginn der britischen Infrastruktur. ” Der nationale Vorsitzende der Föderation der Kleinunternehmen, Mike Cherry, sagte: „Es ist wichtig, dass die Regierung nicht davon abgelenkt wird, große und kleine Infrastrukturprojekte durchzuführen. Kleine Unternehmen verlassen sich täglich besonders auf ein gut gepflegtes lokales Straßennetz. Für Vorzeigeprojekte sollte die Beschaffung für kleine Unternehmen geöffnet werden. Die Steuerzahler werden wissen wollen, dass ihr Geld die fleißigen Unternehmer Großbritanniens unterstützt. Die Verbesserung des Breitbandnetzes, die Bereitstellung des Northern Powerhouse und Investitionen in den Hochwasserschutz sind in diesem Parlament nicht verhandelbar. ” Hinweise für Redakteure Die Nationale Infrastrukturkommission wurde 2015 gegründet, um die Regierung unabhängig zu beraten, wie der langfristige Infrastrukturbedarf Großbritanniens gedeckt werden kann. Die Mitgliedschaft in der Nationalen Infrastrukturkommission ist: Vorsitz: Lord Adonis Stellvertretender Vorsitzender: Sir John Armitt CBE Kommissare: Dame Kate Barker DBE; Professor Tim Besley CBE; Professor David Fisk CB; Andy Green; Dr. Demis Hassabis; Professor Sadie Morgan; Julia Prescot und Bridget Rosewell OBE Die „Top 12“ der Infrastrukturprioritäten, die die Minister im nächsten Jahr vorantreiben müssen, sind: 1. Heathrow 3. Landebahn. Die Regierung sollte alle Vorbereitungsarbeiten abschließen, die erforderlich sind, damit eine parlamentarische Entscheidung auf einer dritten Landebahn für den Flughafen Heathrow getroffen werden kann, und andere luftpolitische Entscheidungen zur Steigerung der Flugverkehrskapazität vor allem im Südosten Englands vorantreiben. Dies erfordert: Ein Unterhaus stimmt spätestens im Mai 2018 über eine endgültige nationale Grundsatzerklärung zur Kapazität von Flughäfen im Südosten Englands ab. Eine Antwort der Regierung auf die Konsultation zum britischen Luftraum, die spätestens im Oktober 2017 veröffentlicht wurde; Ein Zeitplan für die Vereinbarung einer aktualisierten nationalen Luftfahrtstrategie, der spätestens im September 2017 veröffentlicht wird. 2. Hohe Geschwindigkeit 2 Die Regierung sollte den hybriden Gesetzentwurf für Phase 2a (Birmingham nach Crewe) von High Speed ​​2 einführen und die endgültige Route für Phase 2b (Crewe nach Manchester und Birmingham nach Leeds) einschließlich der Verbindungen zu High Speed ​​3 veröffentlichen und die wichtigsten Arbeitsverträge zulassen für das Projekt bis Ende Juli 2017. 3. High Speed ​​3 (Verbindung der großen nördlichen Städte von Liverpool nach Newcastle und Hull) Die Regierung sollte bis Ende 2017 einen einzigen integrierten Plan für die erste Phase von High Speed ​​3 veröffentlichen, der Vorschläge zur Elektrifizierung und Modernisierung der Eisenbahnstrecke zwischen Pennine (Manchester nach Leeds), Pläne für die nördlichen Abschnitte von HS2 und Pläne enthält für die Sanierung des Bahnhofs Manchester Piccadilly, wie im High Speed ​​North-Bericht des NIC dargelegt. 4. Crossrail 2 (Verbindung von Nordosten, Zentral- und Südwesten Londons) Die Regierung sollte bis Ende 2017 einen mit dem Bürgermeister von London vereinbarten Plan zur Finanzierung und schrittweisen Errichtung von Crossrail 2 sowie zur Sicherstellung der erforderlichen Zustimmung des Parlaments unter Berücksichtigung der Empfehlungen im Transport für eine Weltstadt der NIC veröffentlichen Bericht. 5. Ostübergänge der Themse Die Regierung sollte: Entscheidung über die Baugenehmigung für den Silvertown-Tunnel bis Ende Oktober 2017 treffen; kündigen ihre Finanzierungsstrategie für das neue Lower Thames Crossing an (um das überlastete M25 Dartford Crossing zu entlasten) und beginnen spätestens im September 2017 mit der Umweltverträglichkeitsprüfung, um den Weg für eine Konsultation über die detaillierte Route im Jahr 2018 und die Einreichung der Antrag auf Erteilung einer Entwicklungsgenehmigung im Jahr 2019; vereinbaren Sie mit dem Bürgermeister von London eine Politik für die nächste Überquerung der Themse in Ost-London bis Ende 2017, um eine substanzielle neue Wohnsiedlung zu ermöglichen. 6. Flexible Stromversorgungssysteme Die Regierung sollte ihren Plan für intelligente Energiesysteme, wie in ihrer Antwort auf den Smart Power-Bericht des NIC dargelegt, einschließlich der Maßnahmen, die sie ergreifen wird, um einen besseren Einsatz von Stromspeichern, Verbindungsleitungen und Nachfrageflexibilität zu ermöglichen, spätestens im September 2017 veröffentlichen. 7. Erneuerbare Energie Die Regierung sollte ihre festen Vorwärtspläne zur Unterstützung erneuerbarer Energien mindestens bis 2025 veröffentlichen, einschließlich der Verwendung der verbleibenden Mittel aus den im letzten Parlament vereinbarten 730 Mio. GBP bis Oktober 2017 und spezifischer längerfristiger Ziele im Herbstbudget. 8. Dekarbonisierung von Energie Die Regierung sollte ihre Strategie zur Dekarbonisierung von Energie einschließlich ihres Emissionsminderungsplans spätestens im Oktober 2017 veröffentlichen und ihren Weg für das künftige Niveau der „CO2-Preisuntergrenze“ im Herbstbudget festlegen. 9. Hinkley Point C. Die Regierung sollte bis Ende des Jahres eine Strategie und einen Zeitplan veröffentlichen, um die von der britischen Mitgliedschaft bei Euratom erbrachten Dienstleistungen zu ersetzen und die rechtzeitige Lieferung des neuen Kernkraftwerks Hinkley Point C und künftiger Nuklearprojekte zu unterstützen. 10. Breitband und Mobil Die Regierung sollte bis Ende 2017 ihre endgültige Entscheidung über die Verpflichtung zum Breitband-Universaldienst veröffentlichen und akzeptable Mindeststandards für die Mobilfunkabdeckung festlegen, die auf Kennzahlen basieren, die wirklich widerspiegeln, wo Menschen leben, arbeiten und reisen. Darauf sollte innerhalb von sechs Monaten ein glaubwürdiger Lieferplan folgen, in dem die konkreten Schritte dargelegt sind, die die Regierung unternehmen wird, um sicherzustellen, dass sie eingehalten werden. 11. 5G Handy Die Regierung und Ofcom sollten bis Ende 2017 die folgenden Schritte unternehmen, um die Empfehlungen aus dem Connected Future-Bericht des NIC umzusetzen und sich auf den weit verbreiteten Einsatz der 5G-Technologie ab 2020 vorzubereiten: Schließen Sie die Versteigerung des 5G-Spektrums im Bereich von 3,4 bis 3,6 GHz ab und veröffentlichen Sie einen Zeitplan, um die Auktionen anderer wichtiger 5G-Frequenzbänder bis Ende 2019 abzuschließen. Legen Sie einen umfassenden Plan vor, der die Einführung von 5G-Diensten ermöglicht, einschließlich Vorschlägen für den Zugang zu Gebäuden, Grundstücken und anderen Vermögenswerten des öffentlichen Sektors sowie kommerziellen Modellen für die Bereitstellung hochwertiger mobiler Dienste direkt neben dem Autobahnnetz und den Hauptbahnlinien. 12. Wasser- und Hochwasserschutzinfrastruktur Die Regierung sollte die strategische Grundsatzerklärung für Ofwat bis Ende September 2017 fertigstellen und ihre Überprüfung veröffentlichen, in der Vorschläge für ein wirksames Management von Oberflächenwasserüberschwemmungen bis Ende 2017 dargelegt werden.

Artikelnavigation * Institut für Biowissenschaften, Texas Tech University, Lubbock, TX 79409, USA † Naturwissenschaftliches Forschungslabor, Museum, Texas Tech University, Lubbock, TX 79409, USA Suche nach anderen Werken dieses Autors auf: Caleb D. Phillips, ‡ Forschungs- und Testlabor, RTL Genomics, Lubbock, TX 79407, USA John Hanson, Jeremy E. Wilkinson, Lawrence Koenig, Eric Rees, § Abteilung für Tourismus und Wildtiere, Maasai Mara University, 20500, Narok, Kenia Paul Webala, * Institut für Biowissenschaften, Texas Tech University, Lubbock, TX 79409, USA Tigga Kingston Aus dem Symposium „Mit ein wenig Hilfe von meinen Freunden: Mikrobielle Partner in integrativer und vergleichender Biologie (SICB-weit)“, das auf der Jahrestagung der Gesellschaft für integrative und vergleichende Biologie vom 4. bis 8. Januar 2017 in New Orleans, Louisiana, vorgestellt wurde. Anmerkungen des Autors PDF Geteilte Sicht Artikelinhalt Abbildungen & Tabellen Video Audio Zusätzliche Angaben Zitieren Caleb D. Phillips, John Hanson, Jeremy E. Wilkinson, Lawrence Koenig, Eric Rees, Paul Webala, Tigga Kingston, Strukturelle und funktionelle Wechselwirkungen von Mikrobiomen im Nischenraum des Wirts, Integrative und Vergleichende Biologie, Band 57, Ausgabe 4, Oktober 2017, Seiten 743–755, Schließen Email Twitter Facebook Mehr Navigationssuchfilter Suchbegriff für mobile Microsite Suche Zusammenfassung Wirtsassoziierte Mikrobiome sind integrale Bestandteile der Gesundheit des Wirts, aber die Struktur der Mikrobiomgemeinschaft variiert zwischen und innerhalb des Wirts. Es bleibt eine Herausforderung, die Variabilität der Community mit der offensichtlichen Abhängigkeit der Hosts von der Community-Funktion in Einklang zu bringen und zu charakterisieren, wie die funktionale Divergenz über Nischen hinweg verläuft. Hier charakterisieren wir durch die Untersuchung von Darmmikrobiomen und Diäten von drei insektenfressenden Fledermausarten, wie die Gemeinschaftsstruktur durch vorhergesagte funktionelle Eigenschaften von Gemeinschaftsmitgliedern geformt wird. Wir fanden heraus, dass die Wirtsdiät und die Zusammensetzung der Mikrobiomgemeinschaft zwar nicht signifikant miteinander zusammenhängen, die Wirtsdiät und die Metagenomfunktion jedoch, was darauf hindeutet, dass die Diät eher metagenomische Funktionen als Gemeinschaften auswählt. Wir verwenden ein neuartiges Inferenzgerüst, um zu zeigen, wie die Diskordanz zwischen Gemeinschaftsstruktur und funktioneller Variation von der funktionalen Äquivalenz herrührt und durch das Kontinuum gemeinsamer und abgeleiteter Gensätze über mikrobielle Linien hinweg beeinflusst wird. Unsere Ergebnisse helfen zu klären, wie Metagenom-Community-Struktur-Funktions-Beziehungen zu deterministischen Prozessen in der Community-Versammlung beitragen, und beschreiben die Grundlage für metagenomische Unterschiede zwischen ökologisch ähnlichen Wirten. Einführung Mikrobiome, die in Umgebungen lebenden mikrobiellen Gemeinschaften, sind auf der Erde nahezu allgegenwärtig und leben in Boden, Wasser, Eis und extremen Umgebungen sowie in einer Vielzahl von äußeren und inneren Oberflächen von Makroorganismen (Lozupone und Knight 2005). Wirtsassoziierte Mikrobiome werden häufig als Erweiterungen ihrer Wirte angesehen, was den Beitrag mikrobieller Gemeinschaften zur strukturellen Integrität des Wirtsgewebes (Kumar und Mason 2015), zur Wundheilung (Wolcott et al. 2016) und zur Immunfunktion (Round and Mazmanian 2009; Lathrop et al.) Widerspiegelt. 2011) und unter anderem Nährstoffaufnahme (Sommer et al. 2016). Im Allgemeinen ist die Aufrechterhaltung dieser Gemeinschaften bei wirtsoptimalen Zusammensetzungen mit der Gesundheit und Fitness der Wirte verbunden (z. B. Turnbaugh et al. 2007), während allgemein gezeigt wurde, dass eine Störung der Gemeinschaftsstruktur (dh Dysbiose) die Gesundheit und die Grenze des Wirts negativ beeinflusst Mikrobiomdienste (z. B. Turnbaugh und Gordon 2009). In Bezug auf die Biomasse sind Darmmikrobiome die am häufigsten vorkommenden mikrobiellen Systeme, die zusammen mit Säugetieren auftreten. Sie sind größtenteils eine Folge sowohl der nährstoffreichen Umgebung des Verdauungssystems von Säugetieren als auch der vorteilhaften Funktionen, die diese Gemeinschaften ihren Wirten bieten (Muegge et al. 2011) ). In erster Linie kommen Verdauungsmikrobiome den Wirten zugute, indem sie Nährstoffe sowohl über katabolische als auch über anabole Wege liefern (Hollister et al. 2014). Trends in der Zusammensetzung der Gemeinschaft über Verdauungsmikrobiome von Säugetierarten hinweg werden größtenteils durch die Ernährungsgilde des Wirts erklärt (Ley et al. 2008; Phillips et al. 2012); Es gibt konsistente Unterschiede in der Darm-Mikrobiom-Diversität zwischen den Ernährungsstrategien (z. B. Fleischfresser vs. Pflanzenfresser). Unterschiede in der mikrobiellen Metagenomstruktur und -funktion zwischen Wirtsspezies, die überlappende Nischenräume in der Nahrung einnehmen, sind jedoch weniger klar (Bolnick et al. Dies ist eine wichtige Überlegung, da die Fähigkeit von Mikrobiomgemeinschaften, auf bescheidene Merkmalsunterschiede zwischen Wirten zu reagieren, den Anpassungserfolg des Wirts erleichtern sollte. Angesichts der Größe der Metagenome im Verhältnis zu den Genomen sollte eine ausreichende metagenomische Variation vorhanden sein, um die Bildung lokal optimierter mikrobieller Gemeinschaften zu ermöglichen. Die Wechselwirkung zwischen Wirtsumgebung, Variabilität der Zusammensetzung und funktionellem Repertoire ist jedoch kaum bekannt. Die Zusammensetzung der ökologischen Gemeinschaften ist gering Dies wird durch das Zusammenspiel der gefilterten Besiedlung von Arten aus einem historisch begrenzten regionalen Pool, durch Wechselwirkungen zwischen Arten innerhalb der Gemeinschaft und durch Ausbreitung zwischen Gemeinschaften bestimmt (Leibold et al. 2004). Diese Prozesse können deterministisch sein, dh durch Artenattribute beeinflusst werden, oder stochastisch und daher neutral mit re Artenmerkmale (Hubbell 2006). Insbesondere geht die Nischenaneignungstheorie davon aus, dass die beobachtete Gemeinschaftsstruktur das Ergebnis des Wettbewerbs zwischen potenziellen Gemeinschaftsmitgliedern um Nischenräume in einer bestimmten Umgebung ist (Ricklefs und Travis 1980). Merkmalskombinationen, die Arten einen Wettbewerbsvorteil verschaffen, bleiben in der Gemeinschaft erhalten und bilden letztendlich die Grundlage für die Auswahl (Schmidt et al. 2015). In ähnlicher Weise sollte die Zugehörigkeit zu Mikrobiomgemeinschaften durch die direkte Selektion der Gene in mikrobiellen Genomen beeinflusst werden, die der Mikrobe einen funktionellen Vorteil verleihen, beispielsweise solche, die auf die Ernährung des Wirts reagieren. Da Gene jedoch über mikrobielle Linien hinweg geteilt werden, kann eine vergleichbare Gemeinschaftsfunktion durch verschiedene Kombinationen von Linien erreicht werden, dh Gemeinschaften können sich in der taxonomischen Zusammensetzung unterscheiden, aber funktionell ähnlich sein. Dies wurde in Mikrobiomen über menschliche Körperstellen hinweg beobachtet, die sich in der Zusammensetzung der Gemeinschaft stark unterscheiden, jedoch hochkonservierte funktionelle Eigenschaften aufweisen (Human Microbiome Project 2012). Das Erkennen der Beziehung zwischen Genen und Abstammungslinien würde eine Rolle für die Metagenomfunktion in den deterministischen Prozessen ermöglichen, die die Zusammensetzung der Gemeinschaft beeinflussen könnten, und würde dazu beitragen, ein hohes Maß an Variation zu erklären, das Datensätzen von Wirtsspezies gemeinsam ist (Shafquat et al. Neuartige Ansätze, die Funktionsprofile und Gemeinschaft vergleichen Die Zusammensetzung aus denselben Proben wird benötigt, um die Beziehung zwischen Struktur und Funktion besser aufzulösen und die Zusammensetzungsmechanismen zu klären. In dieser Studie erreichen wir dieses Ziel, indem wir charakterisieren, wie die Varianz in der Zusammensetzung der Gemeinschaft statistisch mit der Varianz in der vorhergesagten Metagenomfunktion zusammenhängt. Wir entwickeln unseren Ansatz unter Verwendung 16S-Amplikonsequenzierung aufgrund der Fähigkeit, Funktion und Taxonomie in einem Ausmaß zu verknüpfen, das derzeit für komplexe Gemeinschaften mithilfe der Shotgun-Sequenzierung in Frage gestellt wird. Die Methode kann jedoch auf jeden Datensatz angewendet werden, in dem mikrobielle Taxonomie und Funktion gemeinsam bekannt sind. Wir liefern ein R. Paket (FunkyTax;), das func enthält zur Implementierung der neuartigen Komponenten dieses Analyse-Workflows sowie der Daten für diese Studie. Wir konzentrieren uns auf das Darmmikrobiom von drei insektenfressenden Fledermausarten. Fledermäuse weisen unter Säugetieren über vergleichbare Zeiträume das breiteste Spektrum der Nahrungsentwicklung auf (Dumont et al. 2012), und unterschiedliche Ernährungsstrategien (z. B. Insektenfresser, Frugivoren, Sanguivoren) sind mit konsistenten Unterschieden in der Mikrobiomzusammensetzung verbunden (Phillips et al. 2012; Carrillo-Araujo) et al. Die Mehrheit der Fledermausarten ist jedoch insektenfressend und hat morphologische und Echolokalisierungseigenschaften entwickelt, die eine feinskalige Aufteilung der Insektenbeute ermöglichen (Denzinger und Schnitzler 2013). Zu den beobachteten Futtersuchstrategien gehören insektenfressende Fledermäuse schnell fliegende Luftfalken und Spezialisten für langsamer fliegende Waldinnenräume. Diese unterschiedlichen Futtersuchstrategien führen zu Unterschieden bei zugänglichen Insektenbeutetieren (Denzinger und Schnitzler 2013) und bieten ein System, bei dem phänotypische Unterschiede des Wirts bescheidene und vorhersehbare Unterschiede in der Ernährung auswählen, die sich in Selektionsunterschieden auf den jeweiligen Mikrobiomen niederschlagen können Um die Wechselwirkung zwischen m zu charakterisieren Struktur und Funktion des IKrobioms verwendeten wir Darmmikrobiomproben von drei Arten insektenfressender Fledermäuse aus Kenia, die sich in der Futtersuchstrategie unterscheiden. Wir haben die Hypothese getestet, dass die Variation des Metagenoms durch Unterschiede in der Nahrungszusammensetzung innerhalb einer einzelnen trophischen Nische erklärt werden kann, und die Beziehung zwischen der vorhergesagten Metagenomfunktion und der Zusammensetzung der Mikrobiomgemeinschaft geklärt. Wir diskutieren auch, wie funktionelle Unterschiede im Metagenom zwischen ökologisch ähnlichen Wirtsspezies an die jeweiligen Ökologien angepasst werden können. Materialen und Methoden Sammlung und Verarbeitung Insektenfressende Fledermausarten Hipposideros beatus (Hipposideridae) und Kerivoula cuprosa (Vespertilionidae) wurden im Kakamega-Wald, Kakamega County, Kenia, gefangen. Neoromicia tenuipinnis (Vespertilionidae) wurde am Ufer des Viktoriasees, Kisumu County, Kenia, gefangen. Die Fledermausarten K. cuprosa und H. beatus sind Spezialisten für die Nahrungssuche im Waldinneren, während N. tenuipinnis eine Waldfalkenart am Waldrand ist. Einzelpersonen wurden mit Harfenfallen und Nebelnetzen gefangen genommen. Geschlecht und Fortpflanzungsstatus wurden für jede Person dokumentiert. Die Fledermäuse wurden einzeln in neuen Stoffbeuteln gehalten, bis sie entleert waren, dann wurde Fäkalien gesammelt und in RNALater (Life Technologies, Carlsbad, CA, USA) homogenisiert. Die gesamte DNA wurde aus Stuhlproben unter Verwendung eines für Kingfisher optimierten MO BIO PowerMag-Boden-DNA-Isolierungskits (MO BIO Laboratories, Inc., Carlsbad, CA, USA) auf einer automatisierten Kingfisher Flex-Plattform (Thermo Scientific, Waltham, MA, USA) isoliert. 16S-Amplifikation und Sequenzierung Die Proben wurden zur Sequenzierung unter Verwendung eines Vorwärts- und Rückwärtsfusionsprimers amplifiziert, der die variablen Regionen 1 bis 3 des 16S-Gens umfasste. Der Vorwärtsprimer wurde mit (5'-3 ') dem Illumina i5-Adapter (AATGATACGGCGACCACCGAGATCTACAC), einem 8–10 bp-Barcode, einem Primerpad und 28F (GAGTTTGATCNTGGCTCAG; Wolcott et al. 2009) konstruiert. Der Reverse-Fusion-Primer wurde mit (5'-3 ') dem Illumina i7-Adapter (CAAGCAGAAGACGGCATACGAGAT), einem 8–10 bp-Barcode, einem Primer-Pad und 519R (GAGTTTGATCNTGGCTCAG; Wolcott et al.) Konstruiert. Die Amplifikationen wurden in 25 μl-Reaktionen mit Qiagen durchgeführt HotStar Taq-Mastermix (Qiagen Inc., Valencia, CA, USA), 1 ul jedes 5 uM Primers und 1 ul Matrize. Die Reaktionen wurden an ABI Veriti-Thermocyclern (Applied Biosystems, Carlsbad, CA, USA) unter Verwendung des folgenden thermischen Profils durchgeführt: 5 min bei 95 ° C, dann 30 s bei 35 Zyklen bei 94 ° C, 40 s bei 54 ° C, 1 min bei 72 ° C, gefolgt von 1 min bei 72 min bei 72 ° C und 4 ° C halten. Amplifikation Die Produkte wurden mit eGels (Life Technologies, Grand Island, New York) sichtbar gemacht. Die Produkte wurden äquimolar gepoolt und jeder Pool wurde in zwei Runden mit Agencourt AMPure XP (Beckman Coulter, Indianapolis, IN, USA) in einem Verhältnis von sieben Zehnteln in der Größe ausgewählt AMPure to product. Die Größe der ausgewählten Pools wurde unter Verwendung des Fluorometers Qubit 2.0 (Life Technologie) quantifiziert s) und auf eine Illumina MiSeq (Illumina, Inc., San Diego, CA, USA) 2 × 300-Durchflusszelle bei 10 pM geladen. Amplifikation und Sequenzierung der Cytochromoxidase I. Um den Nachweis von Arthropoden-Beutespezies zu maximieren, wurden zwei separate Cytochromoxidase I (COI) -Mini-Barcode-Primer-Assays für Arthropoden verwendet. Die Bibliothekskonstruktion dieser Assays wurde in einer Reihe von zwei Polymerasekettenreaktionsreaktionen (PCR) durchgeführt. Der erste Assay verwendete MS_Art_1cF (AGATATTGGAACWTTATATTTTATTTTTGG) und MS_Art_2cR (WACTAATCAATTWCCAAATCCTCC) von Pons (2006). Das thermische Profil für die PCR der ersten Runde dieses Assays betrug 3 Minuten lang 94 ° C, gefolgt von 16 Zyklen von 94 ° C für 30 Sekunden, 57 ° C für 30 Sekunden (Abnahme um 0,5 ° C pro Zyklus) und 72 ° C für 30 Sekunden gefolgt von 24 Zyklen von 94 ° C für 30 Sekunden, 53 ° C für 30 Sekunden und 72 ° C für 30 Sekunden, gefolgt von einer abschließenden Verlängerung bei 72 ° C für 10 Minuten. Der zweite COI-Assay verwendete MS_Lep1F (ATTCAACCAATCATAAAGATAT) und MS_LEP2R (CTTATATTATTTATTCGTGGGAAAGC) von Hebert et al. (2004). Das thermische Profil für die PCR der ersten Runde dieses Assays betrug 1 min lang 94 ° C, 1 min lang 6 Zyklen von 94 ° C, 1 min lang 45 ° C, 30 s lang 72 ° C, 1 min lang 15 s lang 72 ° C, gefolgt von 36 Zyklen von 1 Minute lang 94 ° C, 1 Minute lang 30 Sekunden lang 51 ° C und 1 Minute lang 15 Sekunden lang 72 ° C, gefolgt von einer abschließenden Verlängerung 5 Minuten lang bei 72 ° C. Für beide Assays enthielten die Amplifikationen der zweiten Runde die Adapter Illumina i5 und i7, Barcodes mit 8–10 bp, und verwendeten dieselben thermischen Profile, die in Reaktionen der ersten Runde verwendet wurden. Alle nachfolgenden molekularen Verfahren wurden wie oben beschrieben durchgeführt. Datenverarbeitung Sequenzlesepaare wurden unter Verwendung von PEAR (Zhang et al. 2014) zusammengefügt, und Chimärenprüfung, Clustering der operativen taxonomischen Einheit (OTU), Entwicklung der Community-Matrix und taxonomische Zuordnung wurden unter Verwendung standardisierter Protokolle durchgeführt, die in den ergänzenden Informationen beschrieben sind. Alle nachfolgenden statistischen Analysen wurden in R (Team 2015) unter Verwendung von Phyloseq (McMurdie und Holmes 2013), Veganer (Oksanen et al. 2016), Affen (Paradis et al. 2004), Phytools (Revell 2012) und FunkyTax durchgeführt. Gemeinschaftsstruktur Die Abdeckung des Sequenzierungsaufwands wurde visuell unter Verwendung von Alpha-Diversity-Verdünnungskurven der Anzahl der OTUs und der phylogenetischen Diversität bewertet (PD; Faith 1992). Die Seltenheit wurde mit einer Schrittgröße von 250, zwischen 250 und 15.000 klassifizierten Lesevorgängen und 10 Iterationen bei jeder Schrittgröße durchgeführt. Unterschiede in der Alpha-Diversität zwischen Fledermausarten, die aus dem vollständigen Datensatz berechnet wurden, wurden unter Verwendung der Varianzanalyse (ANOVA) bewertet. Die Unterschiede in der Zusammensetzung der Gemeinschaft zwischen den Arten wurden sowohl unter Verwendung taxonomischer (Bray-Curtis; Bray und Curtis 1957) als auch phylogenetischer (UniFrac; Lozupone und Knight 2005) Metriken zusammengefasst. Interindividuelle Beziehungen basierend auf resultierenden Distanzmatrizen wurden unter Verwendung einer nichtmetrischen mehrdimensionalen Skalierung, einer nichtmetrischen mehrdimensionalen Skalierung (NMDS) und der Auswirkungen von Spezies, Geschlecht, zerlegt, und die Wechselwirkung dieser Variablen wurde unter Verwendung einer Permutationsanalyse der Varianz unter Verwendung von Distanzmatrizen (ADONIS) bewertet ) (Anderson 2001). Nach einem signifikanten Ergebnis nur für Wirtsspezies (α = 0,05) wurde Post-hoc-ADONIS paarweise zwischen Wirtsspeziespaaren wiederholt. Um die Unterschiede in der Zusammensetzung der Mikrobiomgemeinschaft zwischen Wirtsspezies weiter zu charakterisieren, wurde der aus NMDS resultierende euklidische Abstand jedes Individuums von seinem jeweiligen Gruppenschwerpunkt aufgezeichnet und Unterschiede in der Gruppendispersion zwischen Fledermausarten wurden unter Verwendung von ANOVA bewertet. Bakterielle OTUs mit signifikant unterschiedlichen Häufigkeiten zwischen Wirtsspezies wurden identifiziert, indem die Auswirkung von Wirtsspezies auf die OTU-Häufigkeiten bewertet wurde. Für diese Analyse wurden OTU-Zählverteilungen unter Verwendung verallgemeinernder linearer Modelle mit einem negativen Binomialfehlerterm wie in DESeq2 implementiert modelliert (Love et al. Eine Falschentdeckungsrate von 5% wurde unter Verwendung einer Benjamini-Hochberg-Mehrfachtestkorrektur kontrolliert (Benjamini und Hochberg 1995). Funktionale Vorhersage Eine Community-Matrix basierend auf der OTU-Auswahl mit geschlossener Referenz unter Verwendung des UCLUST-Algorithmus gegen die Greengenes-Datenbank (DeSantis et al. 2006) wurde erstellt, und die Zähltabelle wurde anschließend hinsichtlich der Variation der genomischen 16S-Kopienzahl korrigiert. Aus dieser Matrix wurde eine auf KEGG-Begriffen basierende Funktionsmatrix (Kanehisa und Goto 2000) entwickelt, indem Annotationen veröffentlichter Bakteriengenome nach dem von Langille et al. Entwickelten PICRUSt-Algorithmus verglichen wurden. (2013). Die Funktion wurde auf allen KEGG-Annotationsebenen beschrieben. Die funktionale Darstellung wurde durch lineare Regression bewertet, wobei zusammenfassende Statistiken einschließlich der Summe der Funktionsvorkommen, der Anzahl der eindeutigen Funktionen und der Anzahl der Lesevorgänge verglichen wurden. Um die metagenomische Vorhersagekraft zu messen, wurde für jede Probe der nächstgelegene sequenzierte Taxonindex (NSTI; Langille et al. 2013) berechnet, der die gewichtete durchschnittliche Abweichung der beobachteten Bakterienlinien von den in der Genomdatenbank dargestellten zusammenfasst. Zusammensetzungsunterschiede in Speziesmetagenomen wurden unter Verwendung von Bray-Curtis-Unähnlichkeiten, ADONIS und NMDS bewertet. Nach einem signifikanten Effekt nur für Wirtsspezies (α = 0. Funktionsgemeinschaftskategorien Um die Beziehung zwischen Struktur und vorhergesagter Funktion zu klären, haben wir funktionale Gemeinschaftskategorien charakterisiert, indem wir gefragt haben, ob sich die einzelnen Funktionen in der Häufigkeit zwischen den Wirtsspezies unterscheiden, und dann die Gemeinschaftskomponenten verglichen, die zu einzelnen vorhergesagten Funktionen beitragen. Wir führten univariate Tests für die Wirkung von Wirtsspezies auf die Häufigkeit jeder vorhergesagten Funktion unter Verwendung einer verallgemeinerten linearen Modellierung durch, wie in DESeq2 (Love et al. Implementiert). Als nächstes wurden für jede Funktion Matrizen konstruiert, die aus Wirten (einzelnen Fledermäusen) durch bakterielle OTUs bestehen, von denen abgeleitet wurde, dass sie dazu beitragen Um die Verzerrung der Zusammensetzung zu verringern, wurden Hellinger-Datentransformationen (Legendre und Gallagher 2001) für jede Matrix durchgeführt. Anschließend wurden die Bray-Curtis-Unähnlichkeiten zwischen Wirt und Wirt berechnet. Die Auswirkung der Wirtsspezies auf die Zusammensetzung der bakteriellen OTUs, die zu einer vorhergesagten Funktion beitragen, wurde bewertet mit ADONIS. Für alle Tests wurde eine Falschentdeckungsrate von 5% unter Verwendung einer Benjamini-Hochberg-Mehrfachtestkorrektur kontrolliert (Benjamini und Hochberg 1995). Die obigen Datenanalyse- und statistischen Tests können mit der R-Funktion TaFuR (verfügbar im Paket FunkyTax) implementiert werden. Der Vergleich von univariaten und multivariaten Testergebnissen bildete die Grundlage für die funktionale Klassifizierung Diese Vergleiche können mit der R-Funktion CatFun durchgeführt werden. Kurz gesagt, dieser Ansatz bewertete zunächst, ob sich die Funktionen in der Häufigkeit zwischen den Wirtsspezies signifikant unterschieden. Es wurde dann bestimmt, ob nicht signifikante Funktionen auf Ähnlichkeit in der Zusammensetzung der Bakteriengemeinschaft unter Wirten zurückzuführen waren (d. H. Konservierte Gemeinschaftskomponenten) oder durch homologe Gensätze beigetragen wurden, die über verschiedene Bakterienlinien hinweg geteilt wurden (d. H. Äquivalente Gemeinschaftskomponenten). Die Funktionsdivergenz korrelierte erwartungsgemäß mit der erwarteten Divergenz der taxonomischen Zusammensetzung (divergierende Gemeinschaftskomponenten), aber divergierende Funktionen resultierten auch aus Häufigkeitsunterschieden (d. H. Verbesserte Gemeinschaftskomponenten). Abb. 1 Diagramm zur Veranschaulichung der statistischen Tests und Schlussfolgerungen zur Klassifizierung von Mikrobiomen in Kategorien der Funktionsgemeinschaft. Die Auswirkung eines interessierenden Faktors (dh der Wirtsspezies) auf die Häufigkeit jeder Funktion wird durch univariate Tests (verallgemeinerte lineare Modellierung; Love et al.) Bewertet. Da jede Metagenomfunktion von einer Teilmenge der Community bereitgestellt wird, werden separate Community-Matrizen pro Funktion erstellt Fassen Sie zusammen, wie sich die OTU-Zusammensetzung, die eine Funktion beisteuert, zwischen einzelnen Wirten unterscheidet. Multivariate Tests (ADONIS; Anderson 2001) werden auf jede Community-Matrix angewendet, um die Auswirkung eines Faktors oder Interesses (in diesem Fall der Wirtsspezies) auf die Zusammensetzung (R-Funktion TaFuR) zu testen. Die Ergebnisse beider Tests werden zur Klassifizierung von Funktionen verwendet (R-Funktion CatFun). Die Mehrfachtestkorrektur nach Benjamini-Hochberg (Benjamini und Hochberg 1995) wird zur Steuerung der Rate falscher Entdeckungen verwendet. Um zu verstehen, wie die Verteilung der vorhergesagten Funktionen über Linien beeinflusst werden kann Häufigkeiten und Klassifikationen in funktionale Gemeinschaftskategorien quantifizierten wir die phylogenetische und taxonomische Verteilung jeder vorhergesagten Funktion tion. Eine gesamte bakterielle Phylogenie wurde aus Greengenes 16S-Sequenzen voller Länge geschätzt, die beobachteten OTUs entsprachen, die unter Verwendung von SSU-ALIGN (Nawrocki und Eddy 2010) ausgerichtet wurden, und die Phylogenie wurde unter Verwendung von FastTree2 geschätzt. Als nächstes wurden separate phylogenetische Bäume für bakterielle OTUs erstellt, die zu jeder vorhergesagten Funktion beitragen, indem alle bakteriellen OTUs, von denen nicht abgeleitet wurde, dass sie zur Häufigkeit jeder Funktion beitragen, von der Gesamtphylogenie entfernt werden. Die Summen der Verzweigungslängen wurden aus den resultierenden Phylogenien berechnet. Daraus wurde die zu jeder Funktion beitragende Gesamtverzweigungslänge als Maß für die phylogenetische Verteilung jeder Funktion verwendet. Eine taxonomische Komponente wurde bereitgestellt, indem die Anzahl der Phyla jeder Funktion zusammengefasst wurde. Die Beziehung zwischen der Häufigkeit des Funktionsrangs und der beitragenden phylogenetischen Verzweigungslänge oder Phyla wurde durch LOESS-Diagramme über ein Schiebefenster mit 10 Funktionsrängen zusammengefasst und unter Verwendung einer linearen Regression statistisch bewertet. Unterschiede in der Verteilung der Verzweigungslängen für Funktionen, die durch Kategorien funktionaler Gemeinschaften (d. H. Konservierte, äquivalente, divergente, erweiterte Gemeinschaften; Fig. 1) bereitgestellt wurden, wurden unter Verwendung von ANOVA getestet. Molekulare Ernährungsanalyse Aus den Bemühungen zur Sequenzierung von COI-Arthropoden-Barcodes wurde eine Diätdatenmatrix entwickelt (siehe ergänzende Informationen). Die Ernährungsmatrix wurde von OTU über Ordnungswerte zusammengefasst, und die Fähigkeit der Wirtsspezies, Unterschiede in der Ernährung zwischen Individuen zu erklären, wurde unter Verwendung von ANOVA bewertet. Der Unterschied in der Zusammensetzung der Beutegemeinschaften, die zwischen den Wirtsspezies konsumiert wurden, wurde unter Verwendung von Bray-Curtis-Unähnlichkeiten, ADONIS und NMDS bewertet. Nach einem signifikanten Effekt nur für Wirtsspezies auf die Variation der Gesamtzusammensetzung der Nahrung (α = 0. Vergleiche der Struktur der Mikrobiomgemeinschaft, der vorhergesagten Funktion und der Wirtsdiät Um die Auswirkungen der Zusammensetzung der Wirtsdiät auf die Struktur und Funktion der Mikrobiomgemeinschaft zu bewerten, wurden Rotationen der Krusten durchgeführt.Dieser Ansatz wurde angewendet, weil sich gezeigt hat, dass der prokrustische Überlagerungsansatz (Gower 1971), der Ordnungslösungen anstelle von Einzelabstandsmaßen vergleicht, in einer Reihe von Szenarien leistungsfähiger ist als Mantel-Tests (Peres-Neto und Jackson 2001). Rotationen, bei denen die Zusammensetzung und Ernährung der Mikrobiomgemeinschaft oder die Metagenomfunktion und -diät verglichen wurden, basierten auf Ergebnissen einer entfernungsbasierten Redundanzanalyse unter Verwendung von Bray-Curtis-Unterschieden, und es wurden separate Vergleiche mit der Zusammensetzung und Ernährung der Gemeinschaft durchgeführt, die auf verschiedenen taxonomischen Ebenen zusammengefasst wurden. Die Signifikanz von Prokrustendrehungen wurde durch Vergleich der beobachteten Residuen mit Nullverteilungen bewertet, die durch Randomisierung von Proben in der gedrehten Matrix durch 1000 Permutationen (Jackson 1955) unter Verwendung von Funktionsprotest im veganen R-Paket erhalten wurden (Oksanen et al. 2016). Resultate und Diskussion Einfluss der Wirtsspezies auf die Mikrobiomdiversität und die Zusammensetzung der Gemeinschaft Die Rarefaktionskurven der Anzahl der bakteriellen OTUs und der PD von Faith als Funktion des Sequenzierungsaufwands näherten sich der Asymptote über die Proben hinweg, was darauf hindeutet, dass die geschätzte Community-Matrix nicht durch einen schlechten Probenaufwand verzerrt wurde (ergänzende Abb. 1, ergänzende Tabelle 1). Darüber hinaus unterschied sich die Verteilung der beobachteten OTUs nicht signifikant von der von Chao1 (F = 0,64, P = 0,83) geschätzten Verteilung, einem Schätzer, der die Häufigkeit von Singletons und Doubletons zur Schätzung der fehlenden Diversität verwendet. Es wurden keine signifikanten Unterschiede in einzigartigen OTUs oder PD zwischen Wirtsspezies beobachtet (Fig. 2A und B). Es wurden auch keine Unterschiede in der Alpha-Diversität gefunden, wenn der identifizierte Ausreißer (TK182019, χ 2 Ausreißertest P-Werte 0,01 und 0,043 für OTUs bzw. PD) entfernt und Vergleiche wiederholt wurden (OTUs, F = 0). 48, P = 0,63; PD, F = 1,35, P = 0,29). Die Variation der Gemeinschaftszusammensetzung zwischen Individuen und Wirtsspezies wurde mit Bray-Curtis- und UniFrac-Messungen der taxonomischen und phylogenetischen multivariaten Distanz charakterisiert. Wirtsspezies erklärten einen signifikanten Anteil der Variation in der Gemeinschaftsmatrix (R 2 = 0,19–0,24, Abb. 3A und B, Ergänzungstabelle 2), und Signifikanz wurde im Allgemeinen beobachtet, wenn Vergleiche paarweise zwischen durchgeführt wurden Wirtsspezies (Ergänzungstabelle 2). Zusätzlich zu den Auswirkungen auf die Zusammensetzung der Mitgliedschaft können signifikante Gruppenunterschiede auch durch Unterschiede in der Variabilität innerhalb der Gruppe erzeugt werden. Die interindividuellen Unterschiede in der Gemeinschaftsstruktur waren jedoch bei allen Fledermausarten ähnlich (Abb. 3C und D), sodass wir zu dem Schluss kamen, dass der Hauptunterschied in der Zusammensetzung der Mikrobiome der Wirtsspezies damit zusammenhängt, welche Bakterienlinien zwischen den Wirtsspezies auftreten. 2 Alpha-Diversität von Mikrobiomen von drei Wirtsspezies, geschätzt als: (A) OTU-Reichtum; und (B) Faiths PD. F-Statistiken und P-Werte beziehen sich auf den ANOVA-Test der Wirkung von Fledermausarten auf die Schätzung der Alpha-Diversität. H = Hipposideros, K = Kerivoula, N = Neoromica. 3 Beta-Diversität von Mikrobiomen von drei Wirtsspezies, geschätzt als: (A) NMDS basierend auf dem Bray-Curtis-Unähnlichkeitsindex; (B) gewichtetes UniFrac; oder (C) ungewichtetes UniFrac; und Gruppendispersion basierend auf (D) Bray-Curtis-Unähnlichkeitsindex; (E) gewichtetes UniFrac; und (F) ungewichtetes UniFrac. F-Statistiken, R 2 - und P-Werte für A) und B) gelten für den ADONIS-Test der Wirkung von Fledermausarten auf Beta-Diversitätsschätzungen, und F-Statistiken und P-Werte für C) und D) gelten für den ANOVA-Test zur Variation in Gruppendispersion erklärt durch Fledermausarten. Da die Wirtsspezies die Zusammensetzung der Gemeinschaft signifikant beeinflussten, haben wir als nächstes die Unterschiede in der bakteriellen OTU-Häufigkeit genauer untersucht. Ein Vergleich der Anzahl gemeinsamer und einzigartiger bakterieller OTUs zwischen Wirtsspezies ergab, dass H. beatus und K. cuprosa, die beiden ökologisch ähnlichen Waldinneren, 30% der studienweit beobachteten OTUs teilten, während beide 23% aller OTUs mit den ökologisch divergierende N. tenuipinnis (dh 53 weniger häufige OTUs; Ergänzungstabelle 3). Wenn die OTU-Häufigkeiten in einem univariaten Screening auf Gruppenunterschiede betrachtet wurden, wurde die größte Anzahl signifikant unterschiedlicher OTUs zwischen H. beatus und N. tenuipinnis beobachtet, den beiden Wirtslinien, die als am unterschiedlichsten angesehen werden können, wenn der phylogenetische Abstand und die Nischendivergenz gemeinsam betrachtet werden . Signifikant unterschiedliche OTUs wurden auf 11 bakterielle Phyla verteilt, wobei Firmicutes und Proteobacteria die am häufigsten beobachteten Klassifikationen waren (ergänzende Abb. 2). Einfluss der Wirtsspezies auf die vorhergesagte Funktionsfähigkeit des Mikrobioms Wir entwickelten eine Metagenom-Funktionsmatrix von Wirten nach KEGG-Begriffen nach Langille et al. (2013), die 5749 vorhergesagte Funktionen umfassten. Lineare Vergleiche der Anzahl der Lesevorgänge, OTUs und KEGG-Terme deuteten darauf hin, dass der Sequenzierungsaufwand ausreichte, um die funktionelle Kapazität des Metagenoms zu charakterisieren (ergänzende Abb. 4). Werte für den nächsten sequenzierten Taxonindex (NSTI; ergänzende Abb. 4), eine von Langille et al. (2013) lagen zur Beurteilung der Abweichung der beobachteten Bakterienlinien von den in der Datenbank dargestellten im Allgemeinen in den für humane Mikrobiomproben beobachteten Bereichen. Dieses Ergebnis deutet auf eine gute Vorhersagekraft der Funktionsmatrix hin, obwohl NSTI-Werte in diesem Bereich mit einer Variation der Metagenom-Vorhersagegenauigkeit verbunden sind (Abb. 3 von Langille et al. (2013)). Es gab einen Effekt der Wirtsspezies auf die Variation in der Funktionsmatrix, der 21–23% der Gesamtvariation erklärte, abhängig davon, ob Funktionsfrequenzen berücksichtigt wurden oder nicht (ADONIS, F = 2. 15, P <0. 01 und F = 2 44, P = <0,01). Wenn die funktionelle Variation post hoc paarweise zwischen Wirtsspezies betrachtet wurde, wurden gemischte Signifikanzmuster beobachtet (Ergänzungstabelle 2). Beziehung zwischen Mikrobiomzusammensetzung und vorhergesagter Funktion Wirte zeigten erhebliche Unterschiede in der relativen Häufigkeit dominanter bakterieller OTUs, aber die Anteile der vorhergesagten Funktionen dominanter Mikrobiome waren relativ konsistent (4), wie im Vergleich der Mikrobiomzusammensetzung zwischen menschlichen Körperstellen (HMPC 2012). Wir stellten die Hypothese auf, dass der Kontrast zwischen Struktur und Funktion der Gemeinschaft teilweise durch die Verteilung der Gene über die Bakterienlinien erklärt werden könnte. Um einen Einblick in diese Beziehung zu erhalten, haben wir zunächst alle 5749 vorhergesagten Funktionen nach Häufigkeit geordnet und dann ihr Auftreten nach Wirtsspezies codiert. Funktionen höherer Rangordnung (ungefähr die höchsten 50% der Ränge) waren im Allgemeinen in der Häufigkeit des Auftretens zwischen Arten ähnlich (Fig. 5A). Zusätzlich beobachteten wir eine starke lineare Beziehung zwischen der funktionellen Rangordnung und der Anzahl der beitragenden bakteriellen Phyla (F = 7326, P <0,01) sowie der funktionellen Rangfolge und der beitragenden bakteriellen phylogenetischen Verzweigungslängen (F = 8367, P <0,01; ergänzende Fig. 5A und B). Diese Daten zeigten, dass die Ranghäufigkeit einer gegebenen Funktion weitgehend durch ihre phylogenetische Verteilung bestimmt wurde. Wir haben diese Beziehung weiter untersucht, indem wir die Varianz der Rangordnungsposition jeder Funktion über die Wirtsspezies berechnet haben (ergänzende Abb. 5C). Die Positionsvariation war für die häufigsten und am wenigsten häufigen Funktionen am geringsten, wobei Funktionen der mittleren Gesamtrangreihenfolge die größte Variation der Rangfolge unter den Wirtsspezies zeigten. Wahrscheinlich ist die verringerte Rangordnungsvarianz der häufigsten Funktionen ein Ergebnis ihres allgegenwärtigen Auftretens über alle oder die meisten bakteriellen Phyla- und phylogenetischen Verzweigungslängen (Ergänzende Abb. Umgekehrt spiegelt die verringerte Rangordnungsvarianz der am wenigsten häufigen Funktionen wahrscheinlich ihre wider kürzlich erfolgte Ableitung (Abb. 4 Balkendiagramme nach einzelnen Wirten und gruppiert nach Wirtsspezies mit (A) relativer Häufigkeit der 20 häufigsten Bakteriengattungen (oder auf der niedrigsten Ebene, für die eine sichere Zuordnung bestand) und (B) relative Häufigkeit der 20 am häufigsten vorhergesagten Metagenomfunktionen (zusammengefasst als KEGG-Begriffe der Stufe 3) in einzelnen Fledermauswirten. 5 Vorhersage der Funktionsverteilung der vorhergesagten Funktionsmikrobiome und entsprechende Kategorien der Funktionsgemeinschaft für jede Funktion: (A) KEGG-Begriffe der Basisstufe von links geordnet nach Ranghäufigkeit nach rechts und gefärbt nach dem Prozentsatz des Auftretens jeder vorhergesagten Funktion in jeder Fledermausart; (B) Ergebnisse der funktionellen Zuordnung Community-Kategorien; (C) Verteilungen der phylogenetischen Verzweigungslänge, die zu jeder Funktion beitragen und nach Gemeinschaftskategorien zusammengefasst sind. Die F-Statistik und der P-Wert sind Ergebnisse des ANOVA-Tests auf Unterschiede in der Verzweigungslängenverteilung zwischen den Kategorien. Siehe ergänzende Abb. 1 und Text für Details. Funktionale Community-Kategorien Da funktionelle Frequenztrends zwischen Metagenomen durch das Muster gemeinsamer und abgeleiteter Gene in der mikrobiellen Phylogenie beeinflusst werden, haben wir einen analytischen Rahmen entwickelt, um zu charakterisieren, wie die Gemeinschaftsstruktur zur Erhaltung und Divergenz vorhergesagter Funktionen zwischen Wirten beiträgt (Abb. 1 und 5 B). Wir fanden heraus, dass ein großer Teil (etwa drei Viertel) aller Funktionen Häufigkeitsverteilungen aufweist, die sich zwischen den Wirtsspezies nicht signifikant unterscheiden. Für die Community-Komponenten, von denen vorhergesagt wird, dass sie diese Funktionen beitragen, haben wir zwei Klassifikationen identifiziert, die auf taxonomischen Zusammensetzungen über Wirtsspezies hinweg basieren. Die erste Klassifizierung, "äquivalente" Community-Komponenten, sind solche, die ähnliche Funktionsfrequenzen zwischen Hosts beitragen, sich jedoch in der Community-Zusammensetzung erheblich unterscheiden. Funktionen, die sich aus „äquivalenten“ Community-Komponenten ergaben, waren überproportional am phylogenetischsten verbreitet (Abb. 5C) und zeigten aufgrund des breiten Spektrums mikrobieller Linien, die zu diesen Funktionen beitragen, konservierte Frequenzen zwischen den Wirten. Die zweite Klassifizierung aus "konservierten" Community-Komponenten war in Bezug auf Zusammensetzung und Funktionshäufigkeit zwischen den Hosts ähnlich. Im Allgemeinen trugen „konservierte“ Community-Komponenten Funktionen bei, die in der unteren Hälfte der Rangordnungsverteilung auftraten, und waren phylogenetisch stärker abgeleitet als die meisten „äquivalenten“ Funktionen. Wir schlagen vor, dass Funktionen, die mit ähnlichen Häufigkeiten über Wirtsspezies hinweg geteilt werden, das vorgeschlagene Kernmetagenom (Tettelin et al. 2005; Shafquat et al. 2014) unter dieser Gruppe von Wirtsspezies darstellen könnten. Vorausgesagte Funktionen, deren Häufigkeit sich zwischen den Wirtsspezies signifikant unterschied, können durch die wirtslinienspezifische Auswahl der Community-Struktur für bestimmte funktionelle Merkmale beeinflusst werden. Wir konnten diese Gruppe von Funktionen identifizieren und die Community-Komponenten, die zu diesen Funktionen beitragen, weiter charakterisieren. Die erste Gruppe, "erweiterte" Community-Komponenten, unterschied sich in der taxonomischen Zusammensetzung zwischen den Hosts nicht signifikant. Frequenzunterschiede in diesen Funktionen wurden durch eine gerechte Zunahme der Häufigkeit von Linien angezeigt, die zu den Funktionen beitragen. Im Vergleich dazu unterschieden sich „divergierende“ Community-Komponenten signifikant in der Community-Zusammensetzung der Linien, die zu einer bestimmten Funktion beitrugen. Bemerkenswerterweise waren sowohl verbesserte als auch divergierende Funktionen in der unteren Hälfte der Rangordnungsverteilung überproportional verteilt (Fig. 5B und C) und wurden durch weniger bakterielle OTUs, Phyla und phylogenetische Verzweigungslänge (ergänzende Fig. 5) beigetragen. Dies legt nahe, dass Unterschiede in der Selektion auf Metagenomen durch Wirtslinien mit ähnlichen Ernährungsökologien durch Selektion auf relativ abgeleitete Metagenomfunktionen auftreten können. Es sollte beachtet werden, dass „divergente“ und „verbesserte“ Funktionen zwar überproportional an energetisch relevanten Merkmalen beteiligt sind (siehe unten), bei relativ abgeleiteten Merkmalen jedoch möglicherweise auch ein lateraler Gentransfer wahrscheinlicher ist (Vos et al. Zukünftige montagebasierte Studien könnten helfen Bestimmen Sie die Beziehung zwischen Transfer und funktionaler Divergenz zwischen Umgebungen. Mögliche adaptive Bedeutung erweiterter und divergenter Funktionen Wir haben vorhergesagte Funktionen, die sich zwischen den Hosts unterschieden, in ihre jeweiligen hierarchischen KEGG-Kategorien eingeteilt. Wir fanden heraus, dass „verbesserte“ und „divergente“ Funktionen, die zu signifikant unterschiedlichen KEGG-Begriffen der Stufe 3 unter den Wirtsspezies beitragen, im Gegensatz zu allen anderen KEGG-Kategorien der Stufe 1 überproportional Kinder von „Stoffwechselprozessen“ waren (χ 2 = 4,31, P = 0) 04, ergänzende Fig. 6), was darauf hindeutet, dass für Gene, die für energetische Anforderungen relevant sind, eine wirtslinienspezifische Metagenomdivergenz aufgetreten ist. Unter den Stoffwechselfunktionen mit signifikanten Gruppenunterschieden gab es eine beträchtliche Vielfalt an zellulären Prozessen. Einige Funktionen waren offensichtlich nicht relevant für Unterschiede zwischen Wirtsspezies (z. B. Flagellenaufbau, Blasenkrebs, Sporulation). Die Einbeziehung solcher Funktionen könnte mit der genomischen Verknüpfung ihrer Gene mit genomischen Regionen zusammenhängen, die ausgewählt werden, um die metagenomische Häufigkeit zu erhöhen, einer unvollständigen Annotation ihrer Funktionen oder den Auswirkungen der Eins-zu-Viele-Beziehung von Genen zu höheren Ebenen Wege. Es ist jedoch bemerkenswert, dass signifikante Funktionen den Metabolismus oder die Biosynthese von Proteinen, Lipiden und Kohlenhydraten umfassten. Angesichts der Tatsache, dass Vergleiche zwischen insektenfressenden Wirtsspezies durchgeführt wurden, können Frequenzunterschiede für Metagenomfunktionen im Zusammenhang mit dem Makromolekülstoffwechsel die für die Wirtslinie spezifische Feinabstimmung des Stoffwechsels widerspiegeln. Der Metabolismus oder die Biosynthese mehrerer Aminosäuren war bei den Wirten unterschiedlich, einschließlich der Biosynthese der essentiellen Aminosäure Lysin und des Metabolismus des essentiellen Nährstoffs Ascorbat. Das Vorhandensein von Arachidonsäuremetabolismus und Fettsäurebiosynthese in dieser Liste könnte auf eine wichtige Rolle für Metagenome bei der Sequestrierung von Zellmembranmolekülen hinweisen, von denen angenommen wird, dass einige Organe während der Senkung der Körpertemperatur wie Torpor stabilisieren (Ruf und Arnold 2008). Auch wurde für K. cuprosa im Vergleich zu N. tenuipinnis ein signifikanter Anstieg der Fettstoffwechselfunktionen abgeleitet. Die Nutzung der intrinsischen Lipidstoffwechselwege von insektenfressenden Fledermäusen wurde als Mechanismus zur Erfüllung der energetischen Anforderungen des volanten Flugs angenommen (Voigt et al. 2010; McGuire et al. 2013; Phillips et al. Aktuelle Daten unterstützen eine Rolle für Metagenome bei fledermausspezifischen Lipidanforderungen. Wirtsdiät, Mikrobiomzusammensetzung und Funktion Wir stellten die Hypothese auf, dass die Ernährungsökologie des Wirts einen primären selektiven Druck auf die Metagenomfunktion darstellt, und charakterisierten die Ernährung des Wirts mithilfe der mitochondrialen COI-Arthropoden-Barcode-Amplikon-Sequenzierung (Hebert et al. 2004; Pons 2006). Es wurde eine schwache Beziehung zwischen klassifizierten COI-Werten und OTUs beobachtet (F = 3,84, P = 0,07), was auf einen Effekt des Probenahmeaufwands auf abgeleitete Diäten hinweist. Es gab jedoch keinen signifikanten Unterschied im Probenahmeaufwand zwischen den Wirtsspezies (F = 0,91, P = 0,43), was darauf hinweist, dass Unterschiede in der Nahrungszusammensetzung zwischen den Wirtsspezies nicht durch den Probenahmeaufwand beeinflusst wurden. Die Anzahl der konsumierten OTUs war je nach Wirtsspezies unterschiedlich. Waldinnenraumspezialisten konsumierten im Durchschnitt mehr OTUs, wobei H. beatus am meisten konsumierte und N. tenuipinnis (Luftfalken) die geringste Beutevielfalt konsumierte (Abb. 6A). Zusätzlich wurde ein signifikanter Anteil der Nahrungsmatrix durch Wirtsspezies erklärt (R 2 = 0,22, Fig. 6B). Angesichts der Kontraste in der Ernährungsnische des Wirts ergaben post-hoc-paarweise Tests signifikante Unterschiede in der Ernährung zwischen N. tenuipinnis und beiden Wirtsarten im Waldinneren (H. cuprosa), während sich die Ernährung dieser beiden letzteren nicht signifikant unterschied (Ergänzungstabelle 2). . 6 Zusammenfassung des Ernährungsdatensatzes für jede Wirtsspezies mit: (A) Alpha-Diversität als Anzahl einzigartiger OTUs (Reichtum), die in der Ernährung von Fledermausarten vertreten sind. F-Statistiken und P-Werte beziehen sich auf den ANOVA-Test der Wirkung von Fledermausarten auf die Schätzung der Alpha-Diversität. (B) Beta-Diversity als NMDS basierend auf ungewichtetem UniFrac. F-Statistiken, R 2 - und P-Werte beziehen sich auf den ADONIS-Test der Wirkung von Fledermausarten auf Schätzungen der Beta-Diversität. Da die Zusammensetzung der Gemeinschaft, die vorhergesagte Funktion und die Ernährungsdatensätze im Allgemeinen die größten Unterschiede zwischen den Arten der Luftfalken (N. tenuipinnis) und einem der beiden Spezialisten für das Waldinnere (H. beatus, K. cuprosa) aufwiesen, bewerteten wir die Kongruenz von Community- und Funktionsdatensätze zum Ernährungsdatensatz unter Verwendung von Prokrustean-Überlagerung (Jackson 1955; Peres-Neto und Jackson 2001). Da die Auswirkungen der Nahrungszusammensetzung auf die gemeinschaftliche und funktionelle Variation je nach taxonomischer Ebene variieren können, haben wir die gemeinschaftlichen und diätetischen Datensätze auf mehreren taxonomischen Ebenen zusammengefasst und für jeden Rang prokrustische Rotationen durchgeführt. Zur Unterstützung einer direkten Auswirkung von Ernährungsunterschieden zwischen Wirten auf die Metagenomfunktion wurde die insgesamt stärkste Korrelation zwischen der auf Beutespeziesebene zusammengefassten Nahrungsmatrix und der vorhergesagten funktionellen Matrix beobachtet (Procrustean Correlation = 0. 52, P = 0. 03, Abb. 7A, ergänzende Tabelle 4). Es gab einen Trend in der Stärke der Korrelation über die Ernährungstaxonomie hinweg, wobei ein Zerfall auftrat, wenn die Ernährung in höheren taxonomischen Rängen zusammengefasst wurde, was darauf hindeutet, dass Ernährungseffekte, die Metagenom-Funktionsprofile zwischen Wirtsspezies unterscheiden, durch Ernährungsunterschiede bestimmt werden, die auf der Ebene der Beutearten oder -gattungen auftreten . Im Gegensatz dazu wurden keine signifikanten Korrelationen zwischen der Gemeinschaft und den auf einer taxonomischen Ebene zusammengefassten Ernährungsmatrizen beobachtet (Fig. 7B, ergänzende Tabelle 5). Diese Ergebnisse legen nahe, dass die Selektion durch die Wirtsdiät auf die Metagenomfunktion und nur sekundär auf die Bakterienlinien einwirkt. Das heißt, da Gene über Bakterienlinien hinweg gemeinsam genutzt werden, können mehrere Bakterienlinien dieselben Funktionen bereitstellen und sind effektiv austauschbar. Die Austauschbarkeit der Linien verdünnt die direkt messbare Reaktion der Zusammensetzung der Mikrobiomgemeinschaft auf die Selektion auf Metagenomfunktion. 7 Korrespondenz zwischen Fledermausdiät und vorhergesagter Funktion und Taxonomie des Mikrobioms. (A) Prokrustische Korrelationen der Funktionsmatrix mit der Ernährungsmatrix, zusammengefasst auf verschiedenen taxonomischen Ebenen. (B) Prokrustische Korrelationen der Gemeinschaft und der Ernährungsmatrizen, beide auf verschiedenen taxonomischen Ebenen zusammengefasst. Dreiecke stellen Korrelationen dar, die durch Permutation als signifikant identifiziert wurden. Die direkte Auswahl der Metagenomfunktion in Kombination mit der Verteilung der Funktionen auf die Mikrobiomgemeinschaften trägt zu komplexen Mustern bei, die die Beziehungen zwischen Wirten und Mikrobiomen beschreiben. In dieser Studie haben wir charakterisiert, wie sich Mikrobiomgemeinschaften dynamisch ändern können und wie sich die Variation der Zusammensetzung auf die vorhergesagte Funktionsfrequenz zwischen Wirten auswirkt.Wir haben unseren analytischen Ansatz angewendet, um die Beziehungen zwischen Metagenomstruktur und -funktion zwischen ähnlichen Ernährungsökologien des Wirts zu verstehen. Unser Ansatz kann jedoch auf eine Reihe von Umgebungen mit allgemeinen Vorhersagen angewendet werden, die in der ergänzenden Abbildung 7 beschrieben sind. In der vorliegenden Studie haben wir Metagenom-Schlussfolgerungen aus dem 16S-Amplikon gezogen Daten, ein Ansatz, der keine Informationen über Gengewinn / -verlust und lateralen Gentransfer enthalten kann, die für beobachtete Linien spezifisch sind; Dies schloss jedoch die Erkennung eines statistischen Signals für Diät-Funktions-Beziehungen nicht aus, das offensichtlicher war als die Beziehungen zwischen Diät und Gemeinschaftsstruktur. Da die mit der Verwendung der Shotgun-Sequenzierung für eine umfassende taxonomische und funktionale Charakterisierung verbundenen Herausforderungen abnehmen, wird der hier vorgestellte Ansatz die Integration der Genomentwicklung und der Ökologie der Gemeinschaft unterstützen. Zusätzliche Angaben Ergänzende Daten online bei ICB erhältlich. Datenzugriff Die mit dieser Studie verknüpften Funktionsmatrizen, Community-Matrizen und Metadaten sind als Beispieldaten mit dem R-Paket FunkyTax verfügbar, verfügbar unter. Die in dieser Studie analysierten Sequenzdaten sind in der SRA unter der Zugangsnummer [PRJNA383585] hinterlegt. Danksagung Wir möchten dem Natural Science Research Laboratory der Texas Tech University für Feldversorgungen, Probenarchivierung und Kreditgenehmigung, Liam Mcguire und Robert Bradley für hilfreiche Kommentare zu einem früheren Entwurf danken, Dylan Schwilk für die Programmierkompetenz, RTL Genomics für Finanzen, Labor und bioinformatische Unterstützung sowie der Kenya Wildlife Service für die Erteilung von Zugangs- und Forschungsgenehmigungen. Finanzierung T. K. wurde durch ein Reisestipendium des Office of International Affairs der Texas Tech University, des College of Arts and Sciences und des Department of Biological Sciences unterstützt. P. W. wurde durch ein Auslandsstipendium der British Ecological Society und der International Foundation of Science unterstützt. Diese Arbeit wurde von der National Science Foundation [Bewilligungsnummer IOS-1638630] unterstützt. Verweise 2001. Eine neue Methode zur nichtparametrischen multivariaten Varianzanalyse. Austal Ecol 26: 32 - 46. 1995. Kontrolle der Rate falscher Entdeckungen: Ein praktischer und leistungsstarker Ansatz für mehrere Tests. J R Stat Soc 57: 289–300. 2014. Die Ernährungsvielfalt des Einzelnen beeinflusst die mikrobielle Vielfalt des Darms bei zwei Süßwasserfischen (Dreistachliger Stichling und Eurasischer Barsch). Ecol Lett 17: 979–87. 1957. Eine Ordination von Hochlandwaldgemeinden im Süden von Wisconsin. Ecol Monogr 27: 325 - 49. 2015. Die Zusammensetzung des Phyllostomid-Fledermaus-Mikrobioms ist mit der Phylogenie und den Fütterungsstrategien des Wirts verbunden. Front Microbiol 6: 447. 2013. Fledermausgilden, ein Konzept zur Klassifizierung des sehr unterschiedlichen Futtersuch- und Echoortungsverhaltens von Fledermäusen mit Mikrochiropteren. Front Physiol 4: 164. 2006. Greengenes, eine mit Chimären überprüfte 16S-rRNA-Gendatenbank und eine mit ARB kompatible Workbench. Appl Environ Microbiol 72: 5069–72. 2012. Morphologische Innovation, Diversifizierung und Invasion einer neuen Anpassungszone. Proc Biol Sci 279: 1797 & ndash; 805. 1992. Erhaltungsbewertung und phylogenetische Vielfalt. Biol Conserv 61: 1 - 10. 1971. Statistische Methoden zum Vergleich verschiedener multivariater Analysen derselben Daten. Mathematik in den archäologischen und historischen Wissenschaften. Edinburgh University Press. p. 138 - 49. 2004. Zehn Arten in einer: Die DNA-Barcodierung enthüllt kryptische Arten im neotropischen Skipper-Schmetterling Astraptes fulgerator. Proc Natl Acad Sci USA 101: 14812 - 17. 2014. Zusammensetzung und funktionelle Merkmale des gastrointestinalen Mikrobioms und ihre Auswirkungen auf die menschliche Gesundheit. Gastroenterology 146: 1449–58. 2006. Neutrale Theorie und die Entwicklung der ökologischen Äquivalenz. Ecology 87: 1387–98. Human Microbiome Project C. 2012. Struktur, Funktion und Vielfalt des gesunden menschlichen Mikrobioms. Nature 486: 207–14. 1955. PROTEST: Ein PROCrustean Randomization TEST der Übereinstimmung der Community-Umgebung. Ökowissenschaften. 2: 297 - 303. 2000. KEGG: Kyoto-Enzyklopädie der Gene und Genome. Nucleic Acids Res 28: 27 - 30. 2015. Mundschutz: Spielt das einheimische Mikrobiom eine Rolle bei der Aufrechterhaltung der Mundgesundheit? Front Cell Infect Microbiol 5: 35. et al. 2013. Predictive Functional Profiling von mikrobiellen Gemeinschaften unter Verwendung von 16S-rRNA-Markergensequenzen. Nat Biotechnol 31: 814 - 21. 2011. Periphere Bildung des Immunsystems durch Kolon-Kommensal-Mikrobiota. Nature 478: 250 - 4. 2001. Ökologisch bedeutsame Transformationen zur Ordination von Artendaten. Oecologia 129: 271 & ndash; 80. et al. 2004. Das Metacommunity-Konzept: Ein Rahmen für eine mehrskalige Community-Ökologie. Ecol Lett 7: 601-13, et al. 2008. Evolution von Säugetieren und ihren Darmmikroben. Science 320: 1647–51. 2014. Moderierte Schätzung der Faltungsänderung und -dispersion für RNA-seq-Daten mit DESeq2. Genome Biol 15: 550. 2005. UniFrac: Eine neue phylogenetische Methode zum Vergleich von mikrobiellen Gemeinschaften. Appl Environ Microbiol 71: 8228–35. 2013. Phänotypische Flexibilität bei wandernden Fledermäusen: saisonale Variation der Körperzusammensetzung, Organgrößen und Fettsäureprofile. J Exp Biol 216: 800–8. 2013. phyloseq: ein R-Paket für reproduzierbare interaktive Analysen und Grafiken von Mikrobiom-Volkszählungsdaten. PLoS One 8: e61217. 2011. Die Ernährung fördert die Konvergenz der Darmmikrobiomfunktionen in der Phylogenie von Säugetieren und beim Menschen. Science 332: 970 - 4. 2004. APE: Analysen der Phylogenetik und Evolution in der R-Sprache. Bioinformatics 20: 289–90. 2001. Wie gut stimmen multivariate Datensätze überein? Die Vorteile eines Procrustean-Überlagerungsansatzes gegenüber dem Mantel-Test. Oecologia 129: 169–78. 2012. Die Mikrobiomanalyse unter Fledermäusen beschreibt Einflüsse der Wirtsphylogenie, der Lebensgeschichte, der Physiologie und der Geographie. Mol Ecol 21: 2617 - 27. 2014. Diätetische und flugenergetische Anpassungen in einem Transkriptom der Speicheldrüse einer insektenfressenden Fledermaus. PLoS One 9: e83512. 2006. DNA-basierte Identifizierung von Beutetieren aus zerstörungsfreien, vollständigen DNA-Extraktionen von Raubtieren unter Verwendung von Arthropoden-Universalprimern. Mol Ecol Notes 6: 623–6. 2012. phytools: ein R-Paket für die phylogenetische vergleichende Biologie (und andere Dinge). Methods Ecol Evol 3: 217-23. 1980. Ein morphologischer Ansatz zur Untersuchung der Organisation der Vogelgemeinschaft. Auk 97: 321–38. 2009. Die Darmmikrobiota formt die intestinalen Immunantworten während Gesundheit und Krankheit. Nat Rev Immunol 9: 313–23. 2008. Auswirkungen mehrfach ungesättigter Fettsäuren auf Winterschlaf und Erstarrung: eine Übersicht und Hypothese. Am J Physiol Regul Integr Comp Physiol 294: R1044 - 52. 2015. Gemeinschaftsversammlung eines euryhalinen Fischmikrobioms während der Salzgehaltakklimatisierung. Mol Ecol 24: 2537–50. 2014. Funktionelle und phylogenetische Assemblierung mikrobieller Gemeinschaften im menschlichen Mikrobiom. Trends Microbiol 22: 261 - 6. 2016. Die Darmmikrobiota moduliert den Energiestoffwechsel im Winterschlaf des Braunbären Ursus arctos. Cell Rep 14: 1655–61. Team RC. 2015. R: eine Sprache und Umgebung für statistische Berechnungen. R Stiftung für statistisches Rechnen, Wien, Österreich. (). et al. 2005. Genomanalyse mehrerer pathogener Isolate von Streptococcus agalactiae: Auswirkungen auf das mikrobielle „Pan-Genom“. Proc Natl Acad Sci USA 102: 13950 - 5. 2009. Das Kerndarmmikrobiom, Energiebilanz und Fettleibigkeit. J Physiol 587: 4153–8. 2007. Das menschliche Mikrobiomprojekt. Nature 449: 804–10. 2010. Tanken während des Fluges: Futtersuchende Fledermäuse verbrennen Lebensmittel schnell und direkt zum Kraftflug. Ecology 91: 2908–17. 2015. Rate des lateralen Gentransfers in Prokaryoten: hoch, aber warum? Trends Microbiol 23: 598 - 605. 2016. Analyse der chronischen Wundmikrobiota von 2 963 Patienten durch 16S-rDNA-Pyrosequenzierung. Wundreparatur Regen 24: 163 - 74. 2009. Bewertung der Bakterienvielfalt zwischen und innerhalb einzelner venöser Beingeschwüre unter Verwendung von bakterieller tagkodierter FLX- und Titanamplikon-Pyrosequenzierung und metagenomischen Ansätzen. BMC Microbiol 9: 226 .. 2014. PEAR: eine schnelle und genaue Zusammenführung von Illumina Paired-End. Bioinformatics 30: 614–20. Anmerkungen des Autors Aus dem Symposium „Mit ein wenig Hilfe von meinen Freunden: Mikrobielle Partner in integrativer und vergleichender Biologie (SICB-weit)“, das auf der Jahrestagung der Gesellschaft für integrative und vergleichende Biologie vom 4. bis 8. Januar 2017 in New Orleans, Louisiana, vorgestellt wurde. © The Author 2017. Herausgegeben von Oxford University Press im Auftrag der Society for Integrative and Comparative Biology. Alle Rechte vorbehalten. Für Berechtigungen senden Sie bitte eine E-Mail an:.

15. Juni 2018 Hervorgehobene technische Nachrichten, Software und Spiele Bereits im März 2017 begann Valve, seine Steam-Regeln zu verschärfen, um die Anzahl der „gefälschten Spiele“ auf der Plattform zu verringern und Entwickler daran zu hindern, die Steam-Systeme zu nutzen, um Gewinne zu erzielen. Dies begann mit Einschränkungen der Berechtigung für Sammelkarten und breitet sich nun auch auf andere Bereiche aus. In einem aktualisierten Beitrag über die private Steamworks-Gruppe erklärt Valve, dass das Team seit der Einschränkung des Zugriffs auf Sammelkarten „gefälschte Spiele auf die Nutzung anderer Steam-Systeme umgestellt hat“. Infolgedessen werden einige weitere Änderungen vorgenommen, die es für Asset-Flips mit geringem Aufwand schwieriger machen, die „Vertrauensmetrik“ von Steam zu erreichen. Steam hat weitere Änderungen angekündigt, um gefälschte Spiele anzugehen. Dies wurde in der privaten Steamworks-Gruppe veröffentlicht (via @reddit) - Steam-Datenbank (@SteamDB) 15. Juni 2018 Von nun an sind Spiele, die die Vertrauensmetrik von Valve nicht erreichen, auf 100 Erfolge beschränkt. Diese Erfolge tragen weder zur globalen Anzahl der Erfolge bei, noch können sie als Teil eines Leistungsschaufensters in einem Steam-Profil angezeigt werden. Diese Spiele tragen auch nicht zur Anzahl der Spielebibliotheken eines Benutzers bei. Sie können nicht als Teil des "Sammler-Showcases" eines Profils angezeigt werden. Schließlich sind diese Spiele auch nicht für Verkaufsgutscheine berechtigt. In dem Beitrag wird weiter erklärt, dass „gefälschte Spiele die Leistung und die Anzahl der Spiele erhöht haben, die Benutzer in ihren Profilen anzeigen können“. Laut Valves eigener Forschung nutzte eine unbedeutende Anzahl von Benutzern dies aus, aber die Existenz dieser gefälschten Spiele führt immer noch zu Verwirrung für den Steam-Algorithmus. Falls Benutzer absichtlich Spiele kaufen, um die Anzahl der Erfolge zu erhöhen, werden sie jetzt auf der Store-Seite über diese Einschränkungen informiert. Natürlich sollten diese Änderungen keine negativen Auswirkungen auf echte, legitime Spiele haben. KitGuru sagt: Ich wäre daran interessiert, dass Valves "Vertrauensmetrik" öffentlich auf Steam Store-Seiten angezeigt wird, obwohl dies zu unnötiger Prüfung legitimer Titel führen könnte. Glaubt ihr, dass Valve bei Titeln mit geringem Aufwand, die Steam überschwemmen, weiterhin härter sein muss? Werden Sie Patron! Überprüfen Sie auch MetallicGear bringt den Neo Qube auf den Markt, ein Zweikammergehäuse MetallicGear, eine Submarke von Phanteks, hat ein neues Zweikammer-Chassis namens Neo Qube auf den Markt gebracht. Entworfen….

606 Hintergrund: ADONIS, eine laufende Beobachtungsstudie in 9 EU-Ländern, bewertet Behandlungsmuster / -ergebnisse bei Patienten (Patienten) mit metastasiertem Nierenzellkarzinom, die mit Sunitinib (SU) der 1. Linie (1 l) und / oder 2. Linie (2 l) behandelt wurden ) Axitinib (AX) nach SU. Die Analyse der Daten ist in vier Teilen geplant, die schrittweise erfolgen sollen, wenn die Daten ausgereift sind. Hier wird die Bewertung der SU-Wirksamkeit bei Patienten mit mittlerem Risiko (INT) vorgestellt. Zukünftige Analysen umfassen Sequenzierungsdaten, SU, gefolgt von AX und anderen Behandlungen (Cabozantinib, Nivolumab und andere); SU- und AX-Therapiemanagementstrategien und Lebensqualität. Methoden: Pts melden sich zu Beginn von 1L SU oder 2L AX nach SU an. Datenschluss: 31. Mai 2018. Die Analyse konzentrierte sich auf 1L SU. Ergebnisse: 467 Punkte, Durchschnittsalter 64 Jahre (Bereich 31–90), 77,7% waren männlich, mit ECOG PS <2 = 90,2% und ECOG PS ≥ 2 = 9,8% zu Beginn der SU. Das mediane progressionsfreie Gesamtüberleben (mPFS) betrug 10,4 Monate (95% CI 9,3–12,5) und das mediane Gesamtüberleben (mOS) 34,0 Monate (95% CI 28,3–46,6). . Für 120 Punkte lagen Daten zu einzelnen Risikofaktoren (RF) vor, die eine Analyse nach INT 1RF- und INT 2RF-Gruppen für diese Untergruppe ermöglichten. Informationen zu klinischen Studien: NCT02184416. Schlussfolgerungen: Für Patienten insgesamt und nach Risikogruppenschichtung wurden die Überlebensschätzungen mit Verbesserungen in der klinischen Praxis im letzten Jahrzehnt in Einklang gebracht. Bei Patienten mit INT-Risiko mit 1RF war das OS Patienten mit gutem Risiko sehr ähnlich. Es sind jedoch weitere Untersuchungen erforderlich, um diese Beobachtungen zu bestätigen. Ergebnis für mit 1 l SU behandelte Patienten: Nach IMDC-Risikogruppe (n = 238) * IMDC gut n = 73 (15,7%) INT n = 117 (25,2%) Schlecht n = 48 (10,3%) mPFS, mo (95% CI) 23. 8 (16. 5–28. 5) 11. 8 (8. 1–17. 4) 4. 6 (2. 5–7. 7) mOS, mo (95% CI) 97. 1 (46. 3 - NE) 33. 5 (20. 5–46. 6) 10. 0 (4. 5–19. 8) Nach IMDC Individuelle RF beim SU-Start (n = 120) Berechnetes IMDC-Gut n = 22 (18,3%) INT 1RF n = 28 (23,3%) INT 2RF n = 17 (14,2%) Schlecht n = 53 (44,2%) mPFS, mo (95% CI) 16. 5 (8. 7–18. 9) 9. 0 (6. 3 - NE) 4. 5–10. 7) 2. 7 (2. 4–3.4) mOS, mo (95% CI) 21. 6 (16. 3 - NE) 20. 5 (15. 5 - NE) 15. 1 (4. 1–1 NE) 8. 7 (4. 9–12. 3) © 2019 American Society of Clinical Oncology
https://hideuri.com/olmL1d

 

 

 

Made with by Álvaro